RNA id: TU135316



Basic Information


Item Value
RNA id TU135316
length 297
lncRNA type inter_gene
GC content 0.44
exon number 1
gene id G117595
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 16817356 ~ 16817652 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tctctctctctctctgtttgtctctctctctttgtctctctctgtttgtctctctctctctctctgtttgtctctctctctttgtctctctctgtttgtctctctctctctctctgtttgtctctctgtctttgtctctgtttgtctctctctctctctatttgtctctctctctttgtctctctctgtttgtctctctctctctctgtttgtctctctctctttgtctctctgtttgtctctctctctctctctgtttgtctctctctctctctctctgtttgtctctctctctct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU135315 lncRNA upstream 101 16816998 ~ 16817255 (+) True G117594
TU135312 lncRNA upstream 7984 16809161 ~ 16809372 (+) True G117591
TU134975 lncRNA upstream 17211 16789601 ~ 16800145 (+) True G117322
TU134969 lncRNA upstream 18599 16788500 ~ 16798757 (+) True G117320
TU134955 lncRNA upstream 53969 16760364 ~ 16763387 (+) True LOC110520867
TU135318 lncRNA downstream 2392 16820044 ~ 16820283 (+) True G117597
TU135323 lncRNA downstream 11405 16829057 ~ 16829411 (+) True G117602
TU135329 lncRNA downstream 25713 16843365 ~ 16849254 (+) True G117608
TU135330 lncRNA downstream 29958 16847610 ~ 16853727 (+) True G117609
TU135331 lncRNA downstream 30604 16848256 ~ 16850358 (+) True G117610
XM_036939646.1 mRNA upstream 50133 16759736 ~ 16767223 (+) False LOC110520867
XM_036961677.1 mRNA upstream 70070 16733333 ~ 16747286 (+) True LOC118936591
XM_036939628.1 mRNA upstream 149928 16516081 ~ 16667428 (+) True LOC110512627
XM_021621796.2 mRNA upstream 518807 16290145 ~ 16298549 (+) True LOC110536177
XM_021621651.2 mRNA upstream 644318 16133770 ~ 16173038 (+) True chrnb2
XM_036939656.1 mRNA downstream 53890 16871542 ~ 16875899 (+) False LOC110536210
XM_036939657.1 mRNA downstream 53890 16871542 ~ 16875899 (+) False LOC110536210
XM_021621876.2 mRNA downstream 58342 16875994 ~ 16879352 (+) True LOC110536226
XM_036939665.1 mRNA downstream 71926 16889578 ~ 16891184 (+) True LOC110536234
XM_021618966.2 mRNA downstream 78648 16896300 ~ 16897824 (+) True LOC110534232
TU134636 other upstream 631572 16183686 ~ 16185784 (+) True G117048
TU133662 other upstream 1365668 15450468 ~ 15451688 (+) True LOC110535842
TU133604 other upstream 1450567 15355858 ~ 15366789 (+) True LOC110535783
TU133587 other upstream 1479654 15337430 ~ 15337702 (+) True G116224
TU133558 other upstream 1480998 15329582 ~ 15336358 (+) True LOC110535811
TU135335 other downstream 178058 16995710 ~ 16998361 (+) True LOC110536275
TU135454 other downstream 232480 17050132 ~ 17050839 (+) True G117704
TU135467 other downstream 255549 17073201 ~ 17073701 (+) True G117714
TU135631 other downstream 582361 17400013 ~ 17409287 (+) False LOC110520798
TU135611 other downstream 592980 17410632 ~ 17421660 (+) False LOC110520798

Expression Profile


TU135316 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU135316 Expression in each Bioproject

Bar chart with 10 bars.
TU135316 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.