RNA id: TU135579



Basic Information


Item Value
RNA id TU135579
length 628
lncRNA type inter_gene
GC content 0.42
exon number 1
gene id G117813
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 17333398 ~ 17334025 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tgtagtctgtcaggtctttacagagcctttatgtgtgtccctaatgtagacagtagtgtagtctgtcaggtctttacagagcctttaggtgagtccctaatgtagacagtagtgtagtctgtcagatctttacagagcctttatgtgtgtccctaatgtagacagtagtgtagtctgtcagatctttacagagcctttaggtgagtccctaatgtagacagtagtgtagtctgtcagatctttacagagcctttaggtgagtccctaatgtagacagtagtgtagtctgtcagatctttacagagcctttaggtgtgtccctaatgtagacagtagtgtagtctgtcagatctaatgtagacagtagtgtagtctgtcagatctttacagagcctttaggtgagtccctaatgtagacagtagtgtagtctgtcagatctttacagagcctttaggtgagtccctaatgtagacagtagtgtagtctgtcaggtctaatgtagacagtagtgtagtctgtcagatctaatgtagacagtagtgtagtctgtcaggtctttacagagcctttaggtgtgtccctaatgtagacagtagtgtagtctgtcagatctttacagagccttta

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU135577 lncRNA upstream 6221 17326947 ~ 17327177 (+) True G117811
TU135575 lncRNA upstream 9204 17323963 ~ 17324194 (+) True G117809
TU135573 lncRNA upstream 13699 17318629 ~ 17319699 (+) True G117807
TU135558 lncRNA upstream 33919 17298264 ~ 17299479 (+) False G117793
TU135559 lncRNA upstream 33919 17299182 ~ 17299479 (+) True G117793
TU135582 lncRNA downstream 1832 17335857 ~ 17336202 (+) True G117816
TU135583 lncRNA downstream 5551 17339576 ~ 17340310 (+) True G117817
TU135587 lncRNA downstream 20082 17354107 ~ 17355366 (+) True G117818
TU135485 lncRNA downstream 43987 17378012 ~ 17382571 (+) False G117728
TU135486 lncRNA downstream 43987 17378012 ~ 17381210 (+) False G117728
XM_036990388.1 mRNA upstream 10979 17169568 ~ 17322419 (+) False LOC100135972
NM_001124312.1 mRNA upstream 12882 17171041 ~ 17320516 (+) True LOC100135972
XR_005035392.1 mRNA upstream 17571 17311128 ~ 17315827 (+) True LOC110520897
XR_005035389.1 mRNA upstream 17583 17311128 ~ 17315815 (+) False LOC110520897
XR_005035390.1 mRNA upstream 17583 17311128 ~ 17315815 (+) False LOC110520897
XM_036939700.1 mRNA downstream 49038 17383063 ~ 17394790 (+) True LOC110520882
XM_036961687.1 mRNA downstream 61318 17395343 ~ 17413889 (+) False LOC110520798
XM_021598292.2 mRNA downstream 88031 17422056 ~ 17425996 (+) True fdps
XM_036939706.1 mRNA downstream 92407 17426432 ~ 17452486 (+) False rusc1
XM_036939710.1 mRNA downstream 92407 17426432 ~ 17452486 (+) False rusc1
TU135467 other upstream 259697 17073201 ~ 17073701 (+) True G117714
TU135454 other upstream 282559 17050132 ~ 17050839 (+) True G117704
TU135335 other upstream 335037 16995710 ~ 16998361 (+) True LOC110536275
TU134636 other upstream 1147614 16183686 ~ 16185784 (+) True G117048
TU133662 other upstream 1881710 15450468 ~ 15451688 (+) True LOC110535842
TU135631 other downstream 65988 17400013 ~ 17409287 (+) False LOC110520798
TU135611 other downstream 76607 17410632 ~ 17421660 (+) False LOC110520798
TU135623 other downstream 76607 17410632 ~ 17421660 (+) False LOC110520798
TU135495 other downstream 121740 17455765 ~ 17458022 (+) True G117735
TU137226 other downstream 1123333 18457358 ~ 18476354 (+) False LOC110536658

Expression Profile


TU135579 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU135579 Expression in each Bioproject

Bar chart with 14 bars.
TU135579 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.