RNA id: TU135486



Basic Information


Item Value
RNA id TU135486
length 435
lncRNA type read_through
GC content 0.51
exon number 2
gene id G117728
representative False

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 17378012 ~ 17382571 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TTCTTTAAACGAAAAAAACGAAACTTTATTAAGAAGTGAGAGACCGGTGGAGTGGTGTTACAGTGATGTCATCATGCCAGGGGACGTTCTCTCTCTACATACACAAAGCAGAGCTCAACACCATCTTTCCTCTTCAGTTTCATCTCTACTTTTCCTCTCGCGTTGTCACTTCCTGAGCAGGGTCACTGTGGGGTCAATCCCGTCTCTCCTCCCTTGGGTCTCTCGGTCCAACAAGCTCCAATGCTGAGTCTAGTGTTGTTTCCTCCTAAATGAGCAACCTGGGTTGACACAGGACTGTGGAGCATCCGACACACAGGACGACCGTCTGGGCATGACTGAACACTGTCGTGATCTTATAGCATCCTGTAGAGAGAACAGTTCAGACACAAATTAACATTCACCTCAATGTCCTGAACGAGACCTACTCGTGTTTTC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU135587 lncRNA upstream 22646 17354107 ~ 17355366 (+) True G117818
TU135583 lncRNA upstream 37702 17339576 ~ 17340310 (+) True G117817
TU135582 lncRNA upstream 41810 17335857 ~ 17336202 (+) True G117816
TU135579 lncRNA upstream 43987 17333398 ~ 17334025 (+) True G117813
TU135577 lncRNA upstream 50835 17326947 ~ 17327177 (+) True G117811
TU135640 lncRNA downstream 24993 17406203 ~ 17407798 (+) False G117839
TU135641 lncRNA downstream 24993 17406203 ~ 17407798 (+) True G117839
TU135628 lncRNA downstream 27704 17408914 ~ 17410036 (+) False LOC110520798
TU135612 lncRNA downstream 31745 17412955 ~ 17421507 (+) False LOC110520798
TU135613 lncRNA downstream 31745 17412955 ~ 17421507 (+) False LOC110520798
XM_036990388.1 mRNA upstream 55593 17169568 ~ 17322419 (+) False LOC100135972
NM_001124312.1 mRNA upstream 57496 17171041 ~ 17320516 (+) True LOC100135972
XR_005035392.1 mRNA upstream 62185 17311128 ~ 17315827 (+) True LOC110520897
XR_005035389.1 mRNA upstream 62197 17311128 ~ 17315815 (+) False LOC110520897
XR_005035390.1 mRNA upstream 62197 17311128 ~ 17315815 (+) False LOC110520897
XM_036939700.1 mRNA downstream 1853 17383063 ~ 17394790 (+) True LOC110520882
XM_036961687.1 mRNA downstream 14133 17395343 ~ 17413889 (+) False LOC110520798
XM_021598292.2 mRNA downstream 40846 17422056 ~ 17425996 (+) True fdps
XM_036939706.1 mRNA downstream 45222 17426432 ~ 17452486 (+) False rusc1
XM_036939710.1 mRNA downstream 45222 17426432 ~ 17452486 (+) False rusc1
TU135467 other upstream 304311 17073201 ~ 17073701 (+) True G117714
TU135454 other upstream 327173 17050132 ~ 17050839 (+) True G117704
TU135335 other upstream 379651 16995710 ~ 16998361 (+) True LOC110536275
TU134636 other upstream 1192228 16183686 ~ 16185784 (+) True G117048
TU133662 other upstream 1926324 15450468 ~ 15451688 (+) True LOC110535842
TU135631 other downstream 18803 17400013 ~ 17409287 (+) False LOC110520798
TU135611 other downstream 29422 17410632 ~ 17421660 (+) False LOC110520798
TU135623 other downstream 29422 17410632 ~ 17421660 (+) False LOC110520798
TU135495 other downstream 74555 17455765 ~ 17458022 (+) True G117735
TU137226 other downstream 1076148 18457358 ~ 18476354 (+) False LOC110536658

Expression Profile


TU135486 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU135486 Expression in each Bioproject

Bar chart with 16 bars.
TU135486 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.