RNA id: TU139973



Basic Information


Item Value
RNA id TU139973
length 481
lncRNA type intronic
GC content 0.49
exon number 3
gene id G121203
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 20568600 ~ 20573951 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cacctggacaaaaggtacacctatgcgagaatgctattcattgactacagctcagccagcgttcaacaccaaagtaccctcaaagctcatcaataagctaaacctacaaacctattccccctcaggagactgaaaagatttggcatgggtcctcagatcctcaaaaggttctacagctgcaccatcgagagcatcctgactggttgcatcactgcctggcactacagagggtagtgcgaacgtcccagtatatcactggggccaagcttcctgccatccgggacctctataccagacggtgtcagaggaaggccctaaaaattgccaaagaccccagccactccagtcatagactgttctctctgctctctgctaccgactgttctctctgctacccctccccctctttacaccactgctactctctgttgttatctatgcgtagtcactttaataactctacctacatgtgcatactacc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU139963 lncRNA downstream 19390 20535842 ~ 20549210 (-) False G121197
TU139954 lncRNA downstream 24931 20535000 ~ 20543669 (-) False G121197
TU139962 lncRNA downstream 24931 20542568 ~ 20543669 (-) True G121197
TU139943 lncRNA downstream 26481 20535000 ~ 20542119 (-) False G121197
TU139947 lncRNA downstream 27230 20538651 ~ 20541370 (-) False G121197
TU139992 lncRNA upstream 11797 20585748 ~ 20628481 (-) True G121219
TU140011 lncRNA upstream 67804 20641755 ~ 20643822 (-) True G121238
TU140013 lncRNA upstream 79048 20652999 ~ 20653565 (-) True LOC110537462
TU139979 lncRNA upstream 120418 20694369 ~ 20695390 (-) True G121209
TU140067 lncRNA upstream 223443 20797394 ~ 20798054 (-) True G121286
XM_036941330.1 mRNA downstream 63731 20465981 ~ 20504869 (-) True LOC110509434
XM_021590389.2 mRNA downstream 63732 20465981 ~ 20504868 (-) False LOC110509434
XM_036941326.1 mRNA downstream 63732 20465981 ~ 20504868 (-) False LOC110509434
XM_036941336.1 mRNA downstream 63732 20465981 ~ 20504868 (-) False LOC110509434
XM_021590343.2 mRNA downstream 66835 20465981 ~ 20501765 (-) False LOC110509434
XM_036941394.1 mRNA upstream 23105 20597056 ~ 20602276 (-) False LOC110537423
XM_021623455.2 mRNA upstream 23105 20597056 ~ 20602488 (-) True LOC110537423
XM_036941433.1 mRNA upstream 77283 20651234 ~ 20654961 (-) False LOC110537462
XR_002475629.2 mRNA upstream 77283 20651234 ~ 20660987 (-) False LOC110537462
XM_036941430.1 mRNA upstream 79953 20653904 ~ 20654963 (-) False LOC110537462
TU139931 other downstream 68013 20498896 ~ 20500587 (-) True G121188
TU139863 other downstream 102811 20462682 ~ 20465789 (-) True LOC110509624
TU139782 other downstream 356233 20211068 ~ 20212367 (-) True G121046
TU139615 other downstream 640140 19924098 ~ 19928460 (-) True LOC110537275
TU139490 other downstream 873036 19693689 ~ 19695564 (-) True LOC118944062
TU139978 other upstream 52606 20626557 ~ 20627700 (-) True G121208
TU140219 other upstream 482647 21056598 ~ 21058849 (-) True G121421
TU140354 other upstream 714665 21288616 ~ 21346687 (-) True G121533
TU140595 other upstream 888742 21462693 ~ 21463030 (-) True G121738
TU140631 other upstream 916316 21490267 ~ 21547037 (-) False G121756

Expression Profile


TU139973 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU139973 Expression in each Bioproject

Bar chart with 19 bars.
TU139973 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.