RNA id: TCONS_00028289


Basic Information

Item Value
RNA id TCONS_00028289
length 526
RNA type mRNA
GC content 0.52
exon number 2
gene id XLOC_014229
representative True

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 40248697 ~ 40328549 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCCGTCTCCAGAGGACTGGCCACAGGAGGTGGGTTTGCCCCAGAGTGCCTTCTCTCCTCGCCCTGCACAGCCCATAGAGAACCTGGTGCCGGACATGGATGAGCTCGGCAAATCACTCCTACTTAGTCTGGACAGCACCAGCAAGAGCCTGTACGCTCAGCCCTTCCCCAGCAAAAAGCCCTCCCTGGAGGAGAGAGCCGCCTAAAACACCTGCCGCCACACAAACAAACTCGTCTTCCACAGCAAAACGCCGTCACATGCTGCTTTTAACAAATCACCGTCGCAAAAATATCGGTCCGTCAGGTTTTCCTTTCGCCCTCACTACTGCCACCCAACCAGATGCTGCCTACTAATCATCCGCACAGGATCAGAAGCTGCTCGTCTGGGCTTTGTTCAGTTCACCACACTGCCAGAGATCATCTGTTCTCATGAACGCAAGTCTACATGTACTAAGTTTTAGCAGCACATCACTGCCATGAAGATGGATTTAACATTGGACCCAAACAGGATTGAGGAATTACAAGCA

Function

GO:

id name namespace
GO:0042127 regulation of cell population proliferation biological_process
GO:0051726 regulation of cell cycle biological_process
GO:0006468 protein phosphorylation biological_process
GO:0043697 cell dedifferentiation biological_process
GO:0016310 phosphorylation biological_process
GO:0005634 nucleus cellular_component
GO:0016592 mediator complex cellular_component
GO:0016740 transferase activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function
GO:0016301 kinase activity molecular_function
GO:0004693 cyclin-dependent protein serine/threonine kinase activity molecular_function
GO:0008353 RNA polymerase II CTD heptapeptide repeat kinase activity molecular_function

KEGG:

id description
ko04151 PI3K-Akt signaling pathway
ko04110 Cell cycle
ko04115 p53 signaling pathway
ko04218 Cellular senescence
ko05200 Pathways in cancer
ko05206 MicroRNAs in cancer
ko05203 Viral carcinogenesis
ko05212 Pancreatic cancer
ko05225 Hepatocellular carcinoma
ko05214 Glioma
ko05220 Chronic myeloid leukemia
ko05218 Melanoma
ko05224 Breast cancer
ko05222 Small cell lung cancer
ko05223 Non-small cell lung cancer
ko05160 Hepatitis C
ko05164 Influenza A
ko05162 Measles
ko05163 Human cytomegalovirus infection
ko05167 Kaposi sarcoma-associated herpesvirus infection
ko05169 Epstein-Barr virus infection
ko05165 Human papillomavirus infection
ko04934 Cushing syndrome
ko01001 Protein kinases

ZFIN:

id description
ZDB-GENE-060503-786 Predicted to enable RNA polymerase II CTD heptapeptide repeat kinase activity and cyclin-dependent protein serine/threonine kinase activity. Predicted to be involved in protein phosphorylation and regulation of cell cycle. Predicted to act upstream of or within cell dedifferentiation; phosphorylation; and regulation of cell population proliferation. Predicted to be part of mediator complex. Predicted to be active in nucleus. Is expressed in brain; gill; gonad; kidney; and retina. Human ortholog(s) of this gene implicated in high grade glioma; lung non-small cell carcinoma; pancreatic adenocarcinoma; pancreatic ductal carcinoma; and primary autosomal recessive microcephaly 12. Orthologous to human CDK6 (cyclin dependent kinase 6).

Ensembl:

ensembl_id ENSDART00000146893

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00030022 lncRNA upstream 110720 40185903 ~ 40212192 (+) False XLOC_014227
TCONS_00030025 lncRNA upstream 110720 40186156 ~ 40212192 (+) False XLOC_014227
TCONS_00030024 lncRNA upstream 117442 40186156 ~ 40205470 (+) False XLOC_014227
TCONS_00028286 lncRNA upstream 117442 40186385 ~ 40205470 (+) True XLOC_014227
TCONS_00030023 lncRNA upstream 130594 40186156 ~ 40192318 (+) False XLOC_014227
TCONS_00030027 lncRNA downstream 4103 40328712 ~ 40333094 (+) False XLOC_014230
TCONS_00030026 lncRNA downstream 4103 40328712 ~ 40333094 (+) True XLOC_014230
TCONS_00028294 lncRNA downstream 12955 40337564 ~ 40340629 (+) True XLOC_014231
TCONS_00030028 lncRNA downstream 367819 40692428 ~ 40736984 (+) True XLOC_014234
TCONS_00030029 lncRNA downstream 863203 41187812 ~ 41191519 (+) True XLOC_014243
TCONS_00028283 mRNA upstream 112520 40171960 ~ 40210392 (+) False XLOC_014227
TCONS_00028284 mRNA upstream 140270 40177246 ~ 40182642 (+) True XLOC_014228
TCONS_00028277 mRNA upstream 157113 40122160 ~ 40165799 (+) False XLOC_014226
TCONS_00028281 mRNA upstream 157113 40145400 ~ 40165799 (+) False XLOC_014226
TCONS_00028275 mRNA upstream 193428 40115977 ~ 40129484 (+) False XLOC_014226
TCONS_00028290 mRNA downstream 10662 40335271 ~ 40344757 (+) False XLOC_014231
TCONS_00028291 mRNA downstream 12848 40337457 ~ 40347943 (+) False XLOC_014231
TCONS_00028292 mRNA downstream 12925 40337534 ~ 40346145 (+) False XLOC_014231
TCONS_00028295 mRNA downstream 25859 40350468 ~ 40374428 (+) True XLOC_014232
TCONS_00028296 mRNA downstream 55162 40379771 ~ 40477359 (+) False XLOC_014233
TCONS_00028276 other upstream 196148 40116262 ~ 40126764 (+) False XLOC_014226
TCONS_00028268 other upstream 267521 40025928 ~ 40055391 (+) False XLOC_014223
TCONS_00028266 other upstream 447965 39874831 ~ 39874947 (+) True XLOC_014221
TCONS_00028264 other upstream 1374226 38948572 ~ 38948686 (+) True XLOC_014217
TCONS_00028262 other upstream 1856261 38464131 ~ 38466651 (+) True XLOC_014213
TCONS_00028293 other downstream 12945 40337554 ~ 40344737 (+) False XLOC_014231
TCONS_00028303 other downstream 633891 40958500 ~ 40958616 (+) True XLOC_014238
TCONS_00028333 other downstream 1864381 42188990 ~ 42189104 (+) True XLOC_014257
TCONS_00028342 other downstream 2012708 42337317 ~ 42337431 (+) True XLOC_014261
TCONS_00028353 other downstream 2408079 42732688 ~ 42735285 (+) False XLOC_014270

Expression Profile

//