RNA id: TU174711



Basic Information


Item Value
RNA id TU174711
length 252
lncRNA type inter_gene
GC content 0.53
exon number 1
gene id G152618
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 48805952 ~ 48806203 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cttcttacggagccactccttagttgccctggctgtgtgtttcgggtcgttgtcatgctggaagacccagccacgacccatcttcaatgctcttactgagggaaggagattgttggccaagatctcgcgatacatggccccatccctccacccctcaaaacggtgcagtcgtcctgtcccttttgcagaaaagcatccccaaagattgatgtttccacctccatgcttcatgtttgggatggtgttcttggg

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU174698 lncRNA downstream 8144 48797541 ~ 48797808 (-) True G152605
TU174689 lncRNA downstream 11748 48793939 ~ 48794204 (-) True G152596
TU174687 lncRNA downstream 13871 48791752 ~ 48792081 (-) True G152594
TU174635 lncRNA downstream 46947 48758783 ~ 48759005 (-) True G152542
TU174432 lncRNA downstream 144914 48659223 ~ 48661038 (-) True G152356
TU174727 lncRNA upstream 3708 48809911 ~ 48812873 (-) True trnas-gcu-2
TU174940 lncRNA upstream 173188 48979391 ~ 48979626 (-) True G152833
TU175004 lncRNA upstream 236823 49043026 ~ 49043255 (-) True G152895
TU175685 lncRNA upstream 405399 49211602 ~ 49211822 (-) True G153535
TU175688 lncRNA upstream 413104 49219307 ~ 49219528 (-) True G153538
XR_005036983.1 mRNA downstream 94722 48701449 ~ 48711230 (-) True LOC118940428
XR_005036982.1 mRNA downstream 95901 48701449 ~ 48710051 (-) False LOC118940428
XM_021564258.2 mRNA downstream 107958 48661451 ~ 48697994 (-) True ptdss2
XM_021564269.2 mRNA downstream 108032 48661451 ~ 48697920 (-) False ptdss2
XM_021564277.2 mRNA downstream 108051 48661451 ~ 48697901 (-) False ptdss2
trnas-gcu mRNA upstream 4149 48810352 ~ 48810433 (-) True trnas-gcu
trnas-gcu-2 mRNA upstream 5268 48811471 ~ 48811552 (-) False trnas-gcu-2
trnas-gcu-3 mRNA upstream 6386 48812589 ~ 48812670 (-) True trnas-gcu-3
XM_021564287.2 mRNA upstream 269890 49076093 ~ 49078840 (-) False ifitm5
XM_021564290.2 mRNA upstream 269890 49076093 ~ 49078840 (-) True ifitm5
TU174069 other downstream 502289 48303311 ~ 48303663 (-) True G152024
TU173950 other downstream 579008 48226299 ~ 48226944 (-) True G151920
TU173905 other downstream 617674 48187958 ~ 48188278 (-) True G151875
TU173467 other downstream 954604 47850785 ~ 47851348 (-) True G151474
TU172611 other downstream 1600519 47194893 ~ 47205433 (-) False G150675
TU176510 other upstream 1295227 50101430 ~ 50107447 (-) False G154300
TU176505 other upstream 1295350 50101553 ~ 50106737 (-) True G154300
TU176559 other upstream 1350483 50156686 ~ 50157825 (-) True G154338
TU177312 other upstream 1609540 50415743 ~ 50452147 (-) True G155003
TU177396 other upstream 1773595 50579798 ~ 50581349 (-) True G155072

Expression Profile


TU174711 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU174711 Expression in each Bioproject

Bar chart with 17 bars.
TU174711 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.