RNA id: TU190203



Basic Information


Item Value
RNA id TU190203
length 301
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G166944
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 60566110 ~ 60566410 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


attagatactttgtcatgcattttctgaatcaaacgcgccaaataaatggacaatttggagatataacgacggaattaacttctctagggtagggggcagcattcagaattttggatgaaaagcatgcccaaattaaatggcctgctactcaggcccagaagatatgatatgcatatatggcaggcgaaaacctgagaaaaatccattcaggaagtagttttctttttggttttgtagttttctattcaatgccattacagtatccattgacttaggactcaaattgcagttcccatgcct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU190194 lncRNA downstream 7299 60558561 ~ 60558811 (-) True G166935
TU190190 lncRNA downstream 11398 60554496 ~ 60554712 (-) True G166931
TU190176 lncRNA downstream 26857 60538654 ~ 60539253 (-) False LOC110492890
TU190147 lncRNA downstream 42196 60523708 ~ 60523914 (-) True G166889
TU190140 lncRNA downstream 48372 60517538 ~ 60517738 (-) True G166882
TU190205 lncRNA upstream 434 60566844 ~ 60567189 (-) True G166946
TU190211 lncRNA upstream 2572 60568982 ~ 60569187 (-) True G166952
TU190239 lncRNA upstream 21413 60587823 ~ 60588047 (-) True G166980
TU190266 lncRNA upstream 39861 60606271 ~ 60606672 (-) True G167006
TU190268 lncRNA upstream 40566 60606976 ~ 60607198 (-) True G167008
XM_021567361.2 mRNA downstream 6364 60537619 ~ 60559746 (-) False LOC110492890
XM_021567353.2 mRNA downstream 95552 60448878 ~ 60470558 (-) True ppp1r3ab
XM_021567342.2 mRNA downstream 110824 60448878 ~ 60455286 (-) False ppp1r3ab
XM_021567347.2 mRNA downstream 110824 60448878 ~ 60455286 (-) False ppp1r3ab
XM_021567334.2 mRNA downstream 128550 60420501 ~ 60437560 (-) False LOC110492857
XM_021567373.2 mRNA upstream 58732 60625142 ~ 60627473 (-) True LOC110492911
XM_021567382.2 mRNA upstream 268747 60835157 ~ 60850501 (-) False LOC110493006
XM_021567381.2 mRNA upstream 268747 60835157 ~ 60850563 (-) True LOC110493006
XM_021567392.2 mRNA upstream 314986 60881396 ~ 60883242 (-) True LOC110493125
XM_021567393.2 mRNA upstream 322383 60888793 ~ 60899520 (-) True zgc:172145
TU190177 other downstream 16931 60540189 ~ 60549179 (-) True LOC110492890
TU190135 other downstream 50588 60515226 ~ 60515522 (-) True G166877
TU190051 other downstream 159302 60402348 ~ 60406808 (-) True G166794
TU189774 other downstream 645780 59919878 ~ 59920330 (-) True G166541
TU189225 other downstream 736095 59828076 ~ 59830015 (-) True LOC110492782
TU191049 other upstream 112313 60678723 ~ 60679041 (-) True G167723
TU191030 other upstream 169561 60735971 ~ 60740351 (-) True G167706
TU191197 other upstream 408352 60974762 ~ 60975021 (-) True G167866
TU191365 other upstream 688102 61254512 ~ 61256015 (-) True G168021
TU191382 other upstream 724729 61291139 ~ 61300092 (-) True LOC110493186

Expression Profile


TU190203 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU190203 Expression in each Bioproject

Bar chart with 13 bars.
TU190203 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.