RNA id: TU223328



Basic Information


Item Value
RNA id TU223328
length 223
lncRNA type inter_gene
GC content 0.57
exon number 1
gene id G197303
representative True

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 86527187 ~ 86527409 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cggtgctttcactctagtggtagcatgagacggagtctacaacccacacaagtggctcaggtagtgcagctcatccaggatggcacatcaatgcgagctgtggcaagaaggtttgctatgtctgtcagcgtagtgtccagagcatggaggcgctaccaggagacaggccagtacatcaggagacgtggaggaggccgtaggagggcaacaacccagcagcagg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU223257 lncRNA upstream 209208 86317641 ~ 86317979 (+) True G197244
TU223231 lncRNA upstream 250495 86276210 ~ 86276692 (+) True G197218
TU223229 lncRNA upstream 255695 86270822 ~ 86271492 (+) True G197216
TU223219 lncRNA upstream 269821 86257120 ~ 86257366 (+) True G197207
TU223218 lncRNA upstream 270243 86256566 ~ 86256944 (+) True G197206
TU223329 lncRNA downstream 105 86527514 ~ 86527789 (+) True G197304
TU223330 lncRNA downstream 2933 86530342 ~ 86530709 (+) True G197305
TU223332 lncRNA downstream 4880 86532289 ~ 86532489 (+) True G197307
TU223339 lncRNA downstream 23059 86550468 ~ 86550873 (+) True G197314
TU223969 lncRNA downstream 45225 86572634 ~ 86572844 (+) True G197863
XM_021575058.2 mRNA upstream 6585 86481275 ~ 86520602 (+) False LOC110498438
XM_021575066.2 mRNA upstream 6585 86481275 ~ 86520602 (+) False LOC110498438
XM_021575072.2 mRNA upstream 6585 86481275 ~ 86520602 (+) False LOC110498438
XM_021575078.2 mRNA upstream 6585 86481275 ~ 86520602 (+) False LOC110498438
XM_021575085.2 mRNA upstream 6585 86481275 ~ 86520602 (+) False LOC110498438
XM_021575240.2 mRNA downstream 28066 86555475 ~ 86564249 (+) True LOC110498585
XM_021575248.2 mRNA downstream 46160 86573569 ~ 86624542 (+) False LOC110498595
XM_021575254.2 mRNA downstream 83620 86611029 ~ 86624542 (+) True LOC110498595
trnag-gcc-2 mRNA downstream 192207 86719616 ~ 86719686 (+) True trnag-gcc-2
trnag-gcc-3 mRNA downstream 192960 86720369 ~ 86720439 (+) True trnag-gcc-3
TU223067 other upstream 390579 86135616 ~ 86136608 (+) True G197069
TU222039 other upstream 1507153 85010464 ~ 85020034 (+) True LOC110498034
TU220995 other upstream 1926863 84596410 ~ 84600324 (+) True G195155
TU220190 other upstream 2967589 83558920 ~ 83559598 (+) True G194395
TU219583 other upstream 3402222 83119327 ~ 83124965 (+) True LOC110497837
TU224599 other downstream 510102 87037511 ~ 87039236 (+) True G198417
TU224773 other downstream 622793 87150202 ~ 87150490 (+) True G198575
TU225027 other downstream 966214 87493623 ~ 87496735 (+) True G198784
TU225054 other downstream 1008527 87535936 ~ 87536928 (+) True G198811
TU225538 other downstream 1339468 87866877 ~ 87867967 (+) True G199223

Expression Profile


TU223328 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU223328 Expression in each Bioproject

Bar chart with 20 bars.
TU223328 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.