RNA id: TU291596



Basic Information


Item Value
RNA id TU291596
length 249
lncRNA type sense_over
GC content 0.31
exon number 1
gene id LOC110519961
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 39646055 ~ 39660579 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CAAAAATATGTCCATATGGGCTTCACTAGTGCATATAGAGTCAGGTTTAAGGGAGAATTTGGCATATATTTTGTAACAATATGTGCAATGTATGTTTTGAAAACCCATGTTTTGATTAATATAAAACCGTTTGAATGAGGTTGTATTTGAGCTAAAGTTCATATTGTGCTTTGTGTAAAGTCTATTAAGACAAATCGTTAATTTATGTTTGTTAAAATATTTCTTTGTTGTTAAGGGGTACACAGACCA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU291581 lncRNA downstream 25275 39617643 ~ 39621075 (-) True G255897
TU291488 lncRNA downstream 130375 39467577 ~ 39515975 (-) True G255808
TU291424 lncRNA downstream 235953 39408086 ~ 39410397 (-) True G255751
TU291344 lncRNA downstream 358173 39283550 ~ 39288177 (-) True LOC118954848
TU291335 lncRNA downstream 370793 39275335 ~ 39275557 (-) True G255686
TU291600 lncRNA upstream 10429 39657027 ~ 39657546 (-) True G255916
TU291618 lncRNA upstream 25420 39672018 ~ 39672218 (-) True G255920
TU291674 lncRNA upstream 99246 39745844 ~ 39750074 (-) True G255966
TU291729 lncRNA upstream 173362 39819960 ~ 39820197 (-) True G256018
TU291735 lncRNA upstream 184512 39831110 ~ 39831325 (-) True G256024
XM_021596868.2 mRNA downstream 3055 39631499 ~ 39643295 (-) False LOC110519957
XM_021596871.2 mRNA downstream 3055 39631499 ~ 39643295 (-) True LOC110519957
XM_036974071.1 mRNA downstream 137539 39411232 ~ 39508811 (-) False LOC110519955
XM_021596864.2 mRNA downstream 137545 39411232 ~ 39508805 (-) False LOC110519955
XM_021596865.2 mRNA downstream 137548 39411232 ~ 39508802 (-) False LOC110519955
XM_021596890.2 mRNA upstream 464608 40111206 ~ 40125263 (-) False LOC110519967
XM_021596892.2 mRNA upstream 464608 40111206 ~ 40125263 (-) False LOC110519967
XM_036974094.1 mRNA upstream 464608 40111206 ~ 40125263 (-) False LOC110519967
XM_036974095.1 mRNA upstream 464608 40111206 ~ 40125263 (-) False LOC110519967
XM_036974096.1 mRNA upstream 464608 40111206 ~ 40125263 (-) True LOC110519967
TU291595 other downstream 607 39644571 ~ 39645743 (-) True G255911
TU291417 other downstream 137648 39399261 ~ 39508702 (-) True LOC110519955
TU287636 other downstream 2912910 36731845 ~ 36733440 (-) True gpatch3
TU286962 other downstream 3288379 36357483 ~ 36357971 (-) True G251681
TU286719 other downstream 3501778 36140112 ~ 36144572 (-) True G251462
TU291727 other upstream 172050 39818648 ~ 39818980 (-) True G256016
TU292346 other upstream 675908 40322506 ~ 40322898 (-) True G256616
TU292362 other upstream 688612 40335210 ~ 40335440 (-) True G256632
TU295117 other upstream 2117219 41763817 ~ 41767588 (-) True G259259
TU295466 other upstream 2639032 42285630 ~ 42293169 (-) False G259576

Expression Profile


TU291596 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU291596 Expression in each Bioproject

Bar chart with 12 bars.
TU291596 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.