RNA id: TCONS_00029162


Basic Information

Item Value
RNA id TCONS_00029162
length 522
RNA type mRNA
GC content 0.49
exon number 5
gene id XLOC_014763
representative True

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 23488241 ~ 23489527 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACATTCTGGACCAGTATGAACTCGGCAAGGAGATTGGAGAGGGAGGATTTGGCAGCGTCTATGAAGGGAAGCGCTTGGAGGATGGCCTTGAGGTGGCAGTAAAAATTGCCAGAAAGCCACCGAACATGAAATACATCAACATCGCTGGTCATCCTGAGCCCCTTCCTTTAGAGATTGGCCTGTTGATACTGGCTCATAGAGGCGGCAAGGTTCCAGAAATCATTGAGCTGCTGGACTGGCAGGACCAGCAGGATCGCACAAAGGAGTACTTCCCACCAGAGTACTACCTGGACGAAGAATACCATGCAGAACCATCCACTGTATGGTCTTTAGGAGTTCTGTTATTCCTGCTGCTGTGTCAACGATTTCCTGAAGTCACGGACACGCAGAGGATCGATGATGGAAACTGGACTGAGCCTGGATTGTCAGAAGAATGCTGTGACTTGATTCAAGCTCTCCTGCAGGAAAACCCAAGCCAGCGGATTCCTCTGGAAGAAATCATTCTCCATCAATGGTTTAAG

Function

GO:

id name namespace
GO:0043066 negative regulation of apoptotic process biological_process
GO:0006468 protein phosphorylation biological_process
GO:0007346 regulation of mitotic cell cycle biological_process
GO:0046777 protein autophosphorylation biological_process
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060503-495 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDART00000133900

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00030224 lncRNA downstream 50844 23436911 ~ 23437397 (-) True XLOC_014760
TCONS_00030223 lncRNA downstream 51754 23435958 ~ 23436487 (-) False XLOC_014760
TCONS_00030222 lncRNA downstream 76380 23410015 ~ 23411861 (-) True XLOC_014758
TCONS_00030221 lncRNA downstream 118989 23368879 ~ 23369252 (-) True XLOC_014756
TCONS_00030220 lncRNA downstream 182521 23305162 ~ 23305720 (-) True XLOC_014755
TCONS_00030225 lncRNA upstream 36751 23526278 ~ 23526561 (-) True XLOC_014764
TCONS_00030226 lncRNA upstream 135586 23625113 ~ 23627905 (-) False XLOC_014768
TCONS_00030227 lncRNA upstream 230742 23720269 ~ 23723983 (-) False XLOC_014772
TCONS_00030228 lncRNA upstream 230742 23720269 ~ 23726829 (-) False XLOC_014772
TCONS_00030229 lncRNA upstream 233341 23722868 ~ 23723990 (-) True XLOC_014772
TCONS_00029161 mRNA downstream 17532 23468771 ~ 23470709 (-) True XLOC_014762
TCONS_00029160 mRNA downstream 35896 23450493 ~ 23452345 (-) True XLOC_014761
TCONS_00029159 mRNA downstream 50841 23436133 ~ 23437400 (-) False XLOC_014760
TCONS_00029158 mRNA downstream 68899 23418078 ~ 23419342 (-) True XLOC_014759
TCONS_00029157 mRNA downstream 105622 23381331 ~ 23382619 (-) True XLOC_014757
TCONS_00029163 mRNA upstream 35831 23525358 ~ 23526638 (-) False XLOC_014764
TCONS_00029164 mRNA upstream 59379 23548906 ~ 23550179 (-) True XLOC_014765
TCONS_00029165 mRNA upstream 84198 23573725 ~ 23576381 (-) True XLOC_014766
TCONS_00029166 mRNA upstream 102721 23592248 ~ 23594914 (-) True XLOC_014767
TCONS_00029167 mRNA upstream 135736 23625263 ~ 23627929 (-) True XLOC_014768
TCONS_00029155 other downstream 268646 23219477 ~ 23219595 (-) True XLOC_014753
TCONS_00029152 other downstream 358940 23128663 ~ 23129301 (-) True XLOC_014751
TCONS_00029151 other downstream 367314 23120398 ~ 23120927 (-) True XLOC_014750
TCONS_00029150 other downstream 373759 23114196 ~ 23114482 (-) True XLOC_014749
TCONS_00029149 other downstream 423403 23064025 ~ 23064838 (-) True XLOC_014748
TCONS_00029179 other upstream 408175 23897702 ~ 23918134 (-) False XLOC_014780
TCONS_00029181 other upstream 425689 23915216 ~ 23918106 (-) True XLOC_014780
TCONS_00029186 other upstream 650253 24139780 ~ 24139894 (-) True XLOC_014784
TCONS_00029188 other upstream 693248 24182775 ~ 24182891 (-) True XLOC_014787
TCONS_00029189 other upstream 698067 24187594 ~ 24188743 (-) True XLOC_014788

Expression Profile

//