RNA id: TU274076



Basic Information


Item Value
RNA id TU274076
length 252
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G239822
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 26125883 ~ 26126134 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


AGTGAAGAAGTGAAGTGTTAGTAGCGGGGTATCAAAACTTCCCAAATCATCCAAGTGAAGTACCAGATTCCACTATTGTGGTATTGCACCTGTAGTTATCTCATCTGTGACCACATTTGTAGGATGAAATGCACCTGCATTAGTGGAATCTGTATGACAATTACGATCTCTATTGAGCTCATGTTCAAGGGGAGATAGGTACTGAACTGGCCTTGCCCTTGATGAGGGTGGATGATGGACAACACCTAACTG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU273716 lncRNA downstream 68882 26055575 ~ 26057001 (-) True G239515
TU273722 lncRNA downstream 141767 25982609 ~ 25984116 (-) True LOC110515882
TU273721 lncRNA downstream 189172 25936223 ~ 25936711 (-) True G239519
TU273703 lncRNA downstream 226753 25898818 ~ 25899130 (-) True G239504
TU273697 lncRNA downstream 249920 25874811 ~ 25875963 (-) True G239502
TU274092 lncRNA upstream 20086 26146220 ~ 26146503 (-) True G239836
TU274109 lncRNA upstream 60869 26187003 ~ 26187203 (-) True G239853
TU274120 lncRNA upstream 82550 26208684 ~ 26209104 (-) True G239864
TU274160 lncRNA upstream 194181 26320315 ~ 26320540 (-) True G239904
TU274198 lncRNA upstream 244618 26370752 ~ 26370991 (-) True G239939
XM_021594617.2 mRNA downstream 31664 26071056 ~ 26094219 (-) False LOC110515898
XM_021594623.2 mRNA downstream 31664 26071056 ~ 26094219 (-) True LOC110515898
XM_036973360.1 mRNA downstream 101326 25918915 ~ 26024557 (-) False LOC110515882
XM_021594587.2 mRNA downstream 207402 25911707 ~ 25918481 (-) True LOC110515870
XM_021594577.2 mRNA downstream 230020 25883818 ~ 25895863 (-) True ica1
XM_036973399.1 mRNA upstream 41334 26167468 ~ 26184953 (-) False LOC110515941
XM_036973369.1 mRNA upstream 41334 26167468 ~ 26185948 (-) False LOC110515941
XM_036973375.1 mRNA upstream 41334 26167468 ~ 26186017 (-) False LOC110515941
XM_036973368.1 mRNA upstream 41334 26167468 ~ 26186018 (-) False LOC110515941
XM_036973390.1 mRNA upstream 41334 26167468 ~ 26186018 (-) False LOC110515941
TU273578 other downstream 301126 25823356 ~ 25824757 (-) True LOC110515750
TU272614 other downstream 889516 25199088 ~ 25236367 (-) True LOC110515384
TU272446 other downstream 1159675 24936516 ~ 24966208 (-) False LOC110515208
TU274740 other upstream 442967 26569101 ~ 26569522 (-) True G240409
TU274804 other upstream 548458 26674592 ~ 26675033 (-) True G240464
TU275014 other upstream 944921 27071055 ~ 27075883 (-) False LOC110516631
TU275018 other upstream 951905 27078039 ~ 27079944 (-) False LOC110516631
TU275019 other upstream 958206 27084340 ~ 27085060 (-) True LOC110516631

Expression Profile


TU274076 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU274076 Expression in each Bioproject

Bar chart with 2 bars.
TU274076 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.