RNA id: TU277198



Basic Information


Item Value
RNA id TU277198
length 251
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G242686
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 28870380 ~ 28870630 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cagagatctacagctgaggtgggagactctgtccaggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaacgaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU277168 lncRNA downstream 37094 28829885 ~ 28833286 (-) True G242657
TU277118 lncRNA downstream 74190 28795001 ~ 28796190 (-) True G242607
TU277106 lncRNA downstream 86920 28781383 ~ 28783460 (-) False LOC110517244
TU277107 lncRNA downstream 86920 28781600 ~ 28783460 (-) True LOC110517244
TU277104 lncRNA downstream 87409 28781600 ~ 28782971 (-) False LOC110517244
TU277199 lncRNA upstream 913 28871543 ~ 28871778 (-) True G242687
TU277219 lncRNA upstream 14839 28885469 ~ 28885674 (-) True G242707
TU277260 lncRNA upstream 41290 28911920 ~ 28912139 (-) True G242747
TU277269 lncRNA upstream 51673 28922303 ~ 28922506 (-) True G242756
TU277270 lncRNA upstream 52307 28922937 ~ 28923157 (-) True G242757
LOC110517244 mRNA downstream 84102 28781596 ~ 28786278 (-) False LOC110517244
XR_002472529.2 mRNA downstream 145086 28719540 ~ 28725294 (-) False LOC110517222
XM_036973742.1 mRNA downstream 516718 28343744 ~ 28353662 (-) True LOC110517198
XM_021595369.2 mRNA downstream 518284 28343744 ~ 28352096 (-) False LOC110517198
XM_021595321.2 mRNA downstream 590303 28275767 ~ 28280077 (-) False LOC110517114
XM_021595405.2 mRNA upstream 20790 28891420 ~ 28921524 (-) False rspo1
XM_036973744.1 mRNA upstream 20790 28891420 ~ 28921524 (-) True rspo1
XM_021595420.2 mRNA upstream 164298 29034928 ~ 29039438 (-) True dnali1
XM_021595453.2 mRNA upstream 325516 29196146 ~ 29201564 (-) True LOC110517348
XM_021595506.2 mRNA upstream 451401 29322031 ~ 29338651 (-) False LOC110517416
TU277105 other downstream 84102 28781600 ~ 28786278 (-) False LOC110517244
TU277045 other downstream 140005 28726970 ~ 28730375 (-) True G242539
TU276998 other downstream 145177 28719454 ~ 28725203 (-) True LOC110517222
TU276553 other downstream 590335 28275772 ~ 28280045 (-) True LOC110517114
TU276496 other downstream 613871 28255157 ~ 28256509 (-) False G242021
TU277309 other upstream 75111 28945741 ~ 28946292 (-) True G242796
TU277694 other upstream 261686 29132316 ~ 29152629 (-) True G243154
TU278065 other upstream 585851 29456481 ~ 29458046 (-) True LOC110517486
TU278954 other upstream 1218213 30088843 ~ 30129214 (-) True G244338
TU278995 other upstream 1303383 30174013 ~ 30177408 (-) True G244379

Expression Profile


TU277198 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU277198 Expression in each Bioproject

Bar chart with 11 bars.
TU277198 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.