RNA id: TU277269



Basic Information


Item Value
RNA id TU277269
length 204
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G242756
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 28922303 ~ 28922506 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CAAGCACCTGTCAAGGACAGTTAAGTGTTATCAGCCACTGCAAATAAAATGACAGATGCACAACTACCATGGACGATATATTTTGGCTACTATCCTAGATAATAAGAGAAAGGTAGCACTTTTGGTAAATTACAACTTTTGTATCCTGTATAGCCTTTGGCTATGAGTAGAAAACGTTGCCCCTCAAATTCATCCAGTATGTAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU277260 lncRNA downstream 10164 28911920 ~ 28912139 (-) True G242747
TU277219 lncRNA downstream 36629 28885469 ~ 28885674 (-) True G242707
TU277199 lncRNA downstream 50525 28871543 ~ 28871778 (-) True G242687
TU277198 lncRNA downstream 51673 28870380 ~ 28870630 (-) True G242686
TU277168 lncRNA downstream 89017 28829885 ~ 28833286 (-) True G242657
TU277270 lncRNA upstream 431 28922937 ~ 28923157 (-) True G242757
TU277297 lncRNA upstream 15826 28938332 ~ 28938663 (-) True G242784
TU277306 lncRNA upstream 19932 28942438 ~ 28942683 (-) True G242793
TU277310 lncRNA upstream 24303 28946809 ~ 28947009 (-) True G242797
TU277318 lncRNA upstream 29030 28951536 ~ 28951753 (-) True G242805
XM_021595405.2 mRNA downstream 779 28891420 ~ 28921524 (-) False rspo1
XM_036973744.1 mRNA downstream 779 28891420 ~ 28921524 (-) True rspo1
LOC110517244 mRNA downstream 136025 28781596 ~ 28786278 (-) False LOC110517244
XR_002472529.2 mRNA downstream 197009 28719540 ~ 28725294 (-) False LOC110517222
XM_036973742.1 mRNA downstream 568641 28343744 ~ 28353662 (-) True LOC110517198
XM_021595420.2 mRNA upstream 112422 29034928 ~ 29039438 (-) True dnali1
XM_021595453.2 mRNA upstream 273640 29196146 ~ 29201564 (-) True LOC110517348
XM_021595506.2 mRNA upstream 399525 29322031 ~ 29338651 (-) False LOC110517416
XM_021595493.2 mRNA upstream 399525 29322031 ~ 29338655 (-) False LOC110517416
XM_021595500.2 mRNA upstream 399525 29322031 ~ 29350168 (-) False LOC110517416
TU277105 other downstream 136025 28781600 ~ 28786278 (-) False LOC110517244
TU277045 other downstream 191928 28726970 ~ 28730375 (-) True G242539
TU276998 other downstream 197100 28719454 ~ 28725203 (-) True LOC110517222
TU276553 other downstream 642258 28275772 ~ 28280045 (-) True LOC110517114
TU276496 other downstream 665794 28255157 ~ 28256509 (-) False G242021
TU277309 other upstream 23235 28945741 ~ 28946292 (-) True G242796
TU277694 other upstream 209810 29132316 ~ 29152629 (-) True G243154
TU278065 other upstream 533975 29456481 ~ 29458046 (-) True LOC110517486
TU278954 other upstream 1166337 30088843 ~ 30129214 (-) True G244338
TU278995 other upstream 1251507 30174013 ~ 30177408 (-) True G244379

Expression Profile


TU277269 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU277269 Expression in each Bioproject

Bar chart with 2 bars.
TU277269 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.