RNA id: TU279110



Basic Information


Item Value
RNA id TU279110
length 252
lncRNA type inter_gene
GC content 0.35
exon number 1
gene id G244466
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 30374891 ~ 30375142 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CAATTAGATGTGTCCATGTGTGTAACAACTGTCATAGAATTGTAAAGCAAGTTTGATTTATTTGGTGAAAAGTACAGTATATGGGTCAGATATGTTGCAGAGCGTTTGGGTATATGTTTTCCATTCCTGTGTGGTTAAAAAATACATTATGGGTTAGGCAGCCCACTATGTCTATTTTTACTTTTCTGGTTTTATGTAGTTTATAGGGCTAGTGTCTGTTTTTCAAAAAACACTGACCCATATGTTTTGAGT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU279071 lncRNA upstream 15034 30358819 ~ 30359857 (+) True G244433
TU279085 lncRNA upstream 68046 30303449 ~ 30306845 (+) True G244447
TU279086 lncRNA upstream 68141 30303389 ~ 30306750 (+) False G244447
TU279084 lncRNA upstream 87105 30286007 ~ 30287786 (+) True G244446
TU279083 lncRNA upstream 90713 30283829 ~ 30284178 (+) True G244445
TU279125 lncRNA downstream 20511 30395653 ~ 30395929 (+) True G244481
TU279126 lncRNA downstream 21991 30397133 ~ 30397350 (+) True G244482
TU279131 lncRNA downstream 31883 30407025 ~ 30407245 (+) True G244487
TU279112 lncRNA downstream 38137 30413279 ~ 30414895 (+) True G244468
TU279226 lncRNA downstream 45889 30421031 ~ 30421268 (+) True G244579
XM_021595665.2 mRNA upstream 7454 30363161 ~ 30367437 (+) False LOC110517739
XM_021595656.2 mRNA upstream 7454 30364758 ~ 30367437 (+) False LOC110517739
XM_021595662.2 mRNA upstream 7454 30364763 ~ 30367437 (+) True LOC110517739
XM_021595618.2 mRNA upstream 32413 30336633 ~ 30342478 (+) True LOC110517685
XR_005051424.1 mRNA upstream 37006 30337723 ~ 30337885 (+) True LOC118964376
XM_036973797.1 mRNA downstream 433 30375575 ~ 30412306 (+) True LOC110504017
XM_036973802.1 mRNA downstream 173429 30548571 ~ 30576208 (+) False LOC110517766
XM_036973798.1 mRNA downstream 173443 30548585 ~ 30576208 (+) True LOC110517766
XR_005051413.1 mRNA downstream 237250 30612392 ~ 30612447 (+) True LOC118964363
XM_021595725.2 mRNA downstream 240056 30615198 ~ 30627079 (+) True LOC110517876
TU278893 other upstream 237327 30132399 ~ 30137564 (+) True G244292
TU278253 other upstream 684095 29668379 ~ 29690796 (+) True G243679
TU277370 other upstream 1340177 29031711 ~ 29034714 (+) True LOC110517275
TU275657 other upstream 2625165 27747347 ~ 27749726 (+) False LOC110516993
TU275655 other upstream 2651097 27715043 ~ 27723794 (+) True LOC110516984
TU279342 other downstream 256628 30631770 ~ 30632533 (+) True G244691
TU279535 other downstream 490424 30865566 ~ 30874608 (+) True G244851
TU279506 other downstream 542889 30918031 ~ 30919146 (+) True LOC110518244
TU279569 other downstream 569596 30944738 ~ 30944862 (+) False LOC110518266
TU279642 other downstream 661375 31036517 ~ 31037252 (+) True G244956

Expression Profile


TU279110 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU279110 Expression in each Bioproject

Bar chart with 4 bars.
TU279110 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.