RNA id: TU304215



Basic Information


Item Value
RNA id TU304215
length 342
lncRNA type intronic
GC content 0.56
exon number 1
gene id G267742
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 48559619 ~ 48559960 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctggcagtgcgcctccttgcacaaaggcggaggtagcggtcctgctgctgggttgttgccctcctacggcctcctccacgtcgcctgatgtactggcctgtctcctggtagcgcctccatgctctggacactacgctgacagacacagcaaaccttcttgccacagctcgcattgatgtgccatcctggatgagctgcactacctgagccacttgtgtgggttgtagactcagtctcatgctaccactagagtgaaagcaccaccagcattcaaaagtgaccaaaacatcagccaggaagcataggaactgagaagtggtctgtggtccccacctgcagaac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU304178 lncRNA downstream 50819 48505343 ~ 48508800 (-) True G267705
TU304179 lncRNA downstream 54406 48504457 ~ 48505213 (-) True G267706
TU302998 lncRNA downstream 241983 48317384 ~ 48317636 (-) True G266644
TU302968 lncRNA downstream 263548 48295856 ~ 48296071 (-) True G266614
TU302967 lncRNA downstream 263764 48295552 ~ 48295855 (-) True G266613
TU304216 lncRNA upstream 123 48560083 ~ 48560535 (-) True G267743
TU304264 lncRNA upstream 60879 48620839 ~ 48621096 (-) True G267785
TU304366 lncRNA upstream 214588 48774548 ~ 48774880 (-) True G267885
TU304367 lncRNA upstream 215070 48775030 ~ 48775399 (-) True G267886
TU304369 lncRNA upstream 217554 48777514 ~ 48780357 (-) True G267888
XM_021584378.2 mRNA downstream 106361 48448398 ~ 48453258 (-) True slc38a11
XM_021597102.2 mRNA downstream 111332 48399830 ~ 48448287 (-) False LOC110520074
XM_021597103.2 mRNA downstream 111332 48399830 ~ 48448287 (-) True LOC110520074
XM_021597104.2 mRNA downstream 138701 48399830 ~ 48420918 (-) False LOC110520074
XM_021597092.2 mRNA downstream 160127 48353409 ~ 48399492 (-) True LOC110520072
XM_036974359.1 mRNA upstream 18076 48578036 ~ 48593507 (-) False LOC110520077
XM_036974358.1 mRNA upstream 18076 48578036 ~ 48610322 (-) False LOC110520077
XM_036974357.1 mRNA upstream 18076 48578036 ~ 48610356 (-) False LOC110520077
XM_036974356.1 mRNA upstream 18076 48578036 ~ 48610361 (-) True LOC110520077
XM_021597118.2 mRNA upstream 238479 48798439 ~ 48824622 (-) False LOC110520082
TU302595 other downstream 526317 48032047 ~ 48033302 (-) True LOC110505248
TU302286 other downstream 959804 47599218 ~ 47599815 (-) True G265988
TU299385 other downstream 3022077 45536332 ~ 45537542 (-) True G263274
TU299078 other downstream 3455356 45099340 ~ 45104263 (-) True LOC110520012
TU299080 other downstream 3547370 45010172 ~ 45012249 (-) True G262993
TU304852 other upstream 935517 49495477 ~ 49495803 (-) True G268310
TU304858 other upstream 942456 49502416 ~ 49502971 (-) True LOC118944672
TU304903 other upstream 1003888 49563848 ~ 49565989 (-) False LOC110520112
TU304905 other upstream 1003888 49563848 ~ 49567474 (-) True LOC110520112
TU305027 other upstream 1307257 49867217 ~ 49871645 (-) True LOC110520119

Expression Profile


TU304215 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU304215 Expression in each Bioproject

Bar chart with 19 bars.
TU304215 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.