RNA id: TU305887



Basic Information


Item Value
RNA id TU305887
length 350
lncRNA type antisense_over
GC content 0.44
exon number 1
gene id G269223
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 50787571 ~ 50788258 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CTGACAACCTCAGAGACACTTTGCCTTAGTTCAGCCGCAGTGCCAGGTTTACTTAGTCCCCTTGTAAATTTCCTGGTCTCCGGATGTACTGGAACTGACATTGTCGAGTCCTGCCTTTCATCAATTTCTTTAGGAATTTATAAAACGTCAAAGAAGAAGAGTAAGAACGGAATCATCAGCCGGCTTTTTCCGTTTCTCCGTCAGCACAAGAGCGCACCTTGAGTTTAAAACTGGGTCATGTTGTGCTGGTTCACTCTGCCTTTTTGATCTCATAATTTGCAACAATTACTAGTGAAAGTTGTATTGTATTATCCCGCAGCTGTTGCACCCCCCCGCTGAGTTGTTGTTGT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU305784 lncRNA upstream 142561 50644993 ~ 50645192 (+) True G269126
TU305736 lncRNA upstream 256813 50527538 ~ 50530940 (+) True G269085
TU305624 lncRNA upstream 344742 50440203 ~ 50443011 (+) True G268989
TU305623 lncRNA upstream 346518 50440203 ~ 50441235 (+) False G268989
TU305672 lncRNA upstream 372210 50415338 ~ 50415543 (+) True G269022
TU305889 lncRNA downstream 698 50788800 ~ 50790055 (+) True G269224
TU305896 lncRNA downstream 16488 50804590 ~ 50809753 (+) True G269231
TU305946 lncRNA downstream 87187 50875289 ~ 50875499 (+) True G269279
TU305956 lncRNA downstream 105034 50893136 ~ 50893372 (+) True G269289
TU305957 lncRNA downstream 106185 50894287 ~ 50894921 (+) True G269290
XM_021597249.2 mRNA upstream 168992 50601983 ~ 50618761 (+) False LOC110520146
XM_021597281.2 mRNA downstream 169912 50958014 ~ 50959445 (+) True LOC110520157
XM_036974548.1 mRNA downstream 277072 51065174 ~ 51110275 (+) False uggt2
XM_036974549.1 mRNA downstream 277072 51065174 ~ 51110275 (+) False uggt2
XM_036974550.1 mRNA downstream 277072 51065174 ~ 51110275 (+) False uggt2
XM_036974551.1 mRNA downstream 277072 51065174 ~ 51110275 (+) True uggt2
TU305730 other upstream 182937 50602302 ~ 50604816 (+) True LOC110520146
TU305367 other upstream 604727 50162301 ~ 50183026 (+) True hoxd3a
TU303972 other upstream 932251 49836617 ~ 49855502 (+) True G267529
TU303803 other upstream 1231915 49554498 ~ 49555838 (+) True G267381
TU303780 other upstream 1275278 49510803 ~ 49512475 (+) True G267358
TU305958 other downstream 110487 50898589 ~ 50900277 (+) True G269291
TU307177 other downstream 785878 51573980 ~ 51578683 (+) False LOC110520169
TU308945 other downstream 2378850 53166952 ~ 53172428 (+) True acvr2aa
TU309190 other downstream 2433325 53221427 ~ 53223265 (+) True LOC110520187
TU309244 other downstream 2503228 53291330 ~ 53336526 (+) False LOC110520190

Expression Profile


TU305887 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU305887 Expression in each Bioproject

Bar chart with 5 bars.
TU305887 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.