RNA id: TU312490



Basic Information


Item Value
RNA id TU312490
length 357
lncRNA type inter_gene
GC content 0.33
exon number 1
gene id G275243
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 55397890 ~ 55398246 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atgttacacattgtgtttttatattcatatggaatgtgtatttgtttatatgacagagtactagggccacactgaagaaaaaggataaagtcataaatttatgaggctggttctttctgcagaaaagctacatattgtttttacagttttgatacttatgacaatgtgatacttaatattctggcacatcagcatgtctttgtttatgaaaccatactgaagtacaatttcacgaaatgccccacatctgtcattttaacaactgtcctcctttaaaacaactggttacaatattatgacttgtttttttcccctctgtggccctaatactctagcattttatatatagccttatag

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU312488 lncRNA downstream 4941 55392257 ~ 55392949 (-) True LOC110520233
TU312480 lncRNA downstream 10666 55386974 ~ 55387224 (-) True G275234
TU312475 lncRNA downstream 22371 55375100 ~ 55375519 (-) True G275229
TU312426 lncRNA downstream 26242 55367204 ~ 55371648 (-) True armc8
TU312428 lncRNA downstream 41459 55355925 ~ 55356431 (-) True G275183
TU312491 lncRNA upstream 1557 55399803 ~ 55400473 (-) True G275244
TU312495 lncRNA upstream 6230 55404476 ~ 55404714 (-) True G275248
TU312496 lncRNA upstream 7259 55405505 ~ 55405705 (-) True G275249
TU312499 lncRNA upstream 11897 55410143 ~ 55411487 (-) False G275250
TU312502 lncRNA upstream 14551 55412797 ~ 55413164 (-) True G275252
XM_036974634.1 mRNA downstream 2887 55392189 ~ 55395003 (-) False LOC110520233
XM_021584437.2 mRNA downstream 6558 55389101 ~ 55391332 (-) True crygs2
XM_021597399.2 mRNA downstream 15729 55375915 ~ 55382161 (-) True LOC110520232
XM_036974626.1 mRNA downstream 26223 55357367 ~ 55371667 (-) False armc8
XM_036974642.1 mRNA upstream 194118 55592364 ~ 55715785 (-) True LOC110504309
XM_021597405.2 mRNA upstream 381257 55779503 ~ 55788119 (-) False LOC110520238
XM_036974651.1 mRNA upstream 381257 55779503 ~ 55821242 (-) False LOC110520238
XM_021597406.2 mRNA upstream 390155 55788401 ~ 55792175 (-) False LOC110520238
XM_036974648.1 mRNA upstream 390155 55788401 ~ 55821210 (-) True LOC110520238
TU312299 other downstream 278678 55103494 ~ 55119212 (-) True LOC110520227
TU311493 other downstream 715085 54679918 ~ 54682805 (-) True G274344
TU309646 other downstream 2146806 53249926 ~ 53251084 (-) True G272713
TU309282 other downstream 2689074 52708183 ~ 52708816 (-) True LOC110520182
TU307459 other downstream 3797660 51597935 ~ 51600230 (-) True il1rl1
TU312498 other upstream 11897 55410143 ~ 55411487 (-) False G275250
TU312500 other upstream 11897 55410143 ~ 55411487 (-) True G275250
TU315090 other upstream 1872536 57270782 ~ 57297762 (-) True si:dkey-91i10.3
TU315188 other upstream 2004738 57402984 ~ 57403575 (-) True G277673
TU315276 other upstream 2186140 57584386 ~ 57589183 (-) True G277749

Expression Profile


TU312490 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU312490 Expression in each Bioproject

Bar chart with 18 bars.
TU312490 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.