RNA id: TU313726



Basic Information


Item Value
RNA id TU313726
length 324
lncRNA type intronic
GC content 0.31
exon number 2
gene id G276333
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 55624195 ~ 55625267 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaataaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaacatgctgtaggtggatatctaatgtataaatgaac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU313712 lncRNA downstream 24006 55599887 ~ 55600189 (-) True G276319
TU312633 lncRNA downstream 32063 55591744 ~ 55592132 (-) True G275376
TU312625 lncRNA downstream 38841 55585126 ~ 55585354 (-) True G275368
TU312623 lncRNA downstream 42560 55581389 ~ 55581635 (-) True G275366
TU312620 lncRNA downstream 45707 55578157 ~ 55578488 (-) True G275363
TU313764 lncRNA upstream 44763 55670030 ~ 55671242 (-) True G276368
TU313768 lncRNA upstream 50722 55675989 ~ 55676217 (-) True G276372
TU313770 lncRNA upstream 59365 55684632 ~ 55684865 (-) True G276374
TU313775 lncRNA upstream 66445 55691712 ~ 55692135 (-) True G276379
TU313786 lncRNA upstream 77709 55702976 ~ 55703179 (-) True G276389
XM_036974634.1 mRNA downstream 229192 55392189 ~ 55395003 (-) False LOC110520233
XM_021584437.2 mRNA downstream 232863 55389101 ~ 55391332 (-) True crygs2
XM_021597399.2 mRNA downstream 242034 55375915 ~ 55382161 (-) True LOC110520232
XM_036974627.1 mRNA downstream 252528 55357367 ~ 55371667 (-) False armc8
XM_021597405.2 mRNA upstream 154236 55779503 ~ 55788119 (-) False LOC110520238
XM_036974651.1 mRNA upstream 154236 55779503 ~ 55821242 (-) False LOC110520238
XM_021597406.2 mRNA upstream 163134 55788401 ~ 55792175 (-) False LOC110520238
XM_036974648.1 mRNA upstream 163134 55788401 ~ 55821210 (-) True LOC110520238
XM_036974661.1 mRNA upstream 265115 55890382 ~ 55915483 (-) False LOC110520241
TU312498 other downstream 212708 55410143 ~ 55411487 (-) False G275250
TU312500 other downstream 212708 55410143 ~ 55411487 (-) True G275250
TU312299 other downstream 504983 55103494 ~ 55119212 (-) True LOC110520227
TU311493 other downstream 941390 54679918 ~ 54682805 (-) True G274344
TU309646 other downstream 2373111 53249926 ~ 53251084 (-) True G272713
TU315090 other upstream 1645515 57270782 ~ 57297762 (-) True si:dkey-91i10.3
TU315188 other upstream 1777717 57402984 ~ 57403575 (-) True G277673
TU315276 other upstream 1959119 57584386 ~ 57589183 (-) True G277749
TU322065 other upstream 7089308 62714575 ~ 62715177 (-) True G284018
TU324819 other upstream 9344282 64969549 ~ 64970755 (-) True G286522

Expression Profile


TU313726 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU313726 Expression in each Bioproject

Bar chart with 16 bars.
TU313726 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.