RNA id: TU322065



Basic Information


Item Value
RNA id TU322065
length 603
RNA type TUCP
GC content 0.46
exon number 1
gene id G284018
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 62714575 ~ 62715177 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTTGAGGGGAAAAGCACAAGGTTAGTGAGAGATTCGAGAGACATCTCTCTCTTTATGATAAGAGGCACAAAATAACAATATATTACAGTCTTTACAAGACAAATAATTTACACAAAATTAAAACATGATGGTATCAGCTTTTATATGGATATTACACATGTGTGATCTGACACTGGAGCCATACACACATCTATGCTACTGTATACAAAAATCTTCAAATCTTCAAATCTTCAAAGACTTGGTAAATGTTGTTTTTATTTGACAGATCTTGGGATGTATGTAGCCTACAGCCTAATGGCTGGAAGAGTAGTCGAGTCTGCAGACACAGAGGGCTGCAGACACAGAGAGCTGCAGACACAGAGAGCTGCAGGCACAGAGAGCTGCAGACACAGAGCTCTGCAGACAGAGCTCTGCAGACACAGAGCGCTGCAGACACAGAGAGCTGCAGACACAGAGAGCTGCAGACACAGAGCGCTGCAGACACAGAGCTCTGCAGACACAGAGCTCTGCAGACAGAGCTCTGCAGACACAGAGCGCTGCAGACACAGAGAGCTGCAGACATCGAGAGCTGCAGACACAGAGAGCTGCAGACACAGAGCGCTG

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU322059 lncRNA downstream 10473 62703779 ~ 62704102 (-) True G284012
TU322044 lncRNA downstream 44175 62670174 ~ 62670400 (-) True G283998
TU322036 lncRNA downstream 58809 62655557 ~ 62655766 (-) True G283992
TU322034 lncRNA downstream 59698 62653440 ~ 62654877 (-) False G283991
TU322035 lncRNA downstream 59698 62654177 ~ 62654877 (-) True G283991
TU322070 lncRNA upstream 9844 62725021 ~ 62726045 (-) True G284023
TU322087 lncRNA upstream 27344 62742521 ~ 62742930 (-) True G284040
TU322235 lncRNA upstream 119317 62834494 ~ 62835450 (-) False G284162
TU322236 lncRNA upstream 119317 62834494 ~ 62836044 (-) True G284162
TU322301 lncRNA upstream 139406 62854583 ~ 62854787 (-) True G284213
XR_002472970.2 mRNA downstream 118876 62547867 ~ 62595699 (-) False LOC110520350
XM_021597611.2 mRNA downstream 118878 62556860 ~ 62595697 (-) True LOC110520350
trnal-caa-2 mRNA downstream 171246 62543221 ~ 62543329 (-) True trnal-caa-2
trnal-caa mRNA downstream 171877 62542589 ~ 62542698 (-) True trnal-caa
XM_021597602.2 mRNA downstream 181268 62425684 ~ 62533307 (-) False LOC110520347
XM_036974881.1 mRNA upstream 33247 62748424 ~ 62780309 (-) False LOC110520353
XM_036974882.1 mRNA upstream 33247 62748424 ~ 62780312 (-) True LOC110520353
XM_021597618.2 mRNA upstream 117731 62832908 ~ 62841097 (-) True LOC110520357
XM_036974884.1 mRNA upstream 126283 62841460 ~ 62853625 (-) False LOC110520356
XM_021597617.2 mRNA upstream 126283 62841460 ~ 62853882 (-) False LOC110520356
TU315276 other downstream 5125392 57584386 ~ 57589183 (-) True G277749
TU315188 other downstream 5311000 57402984 ~ 57403575 (-) True G277673
TU315090 other downstream 5416813 57270782 ~ 57297762 (-) True si:dkey-91i10.3
TU312498 other downstream 7303088 55410143 ~ 55411487 (-) False G275250
TU312500 other downstream 7303088 55410143 ~ 55411487 (-) True G275250
TU324819 other upstream 2254372 64969549 ~ 64970755 (-) True G286522
TU324898 other upstream 2299082 65014259 ~ 65029736 (-) True G286580
TU324968 other upstream 2339523 65054700 ~ 65055211 (-) False G286638
TU324969 other upstream 2339523 65054700 ~ 65075985 (-) True G286638
TU325334 other upstream 2520003 65235180 ~ 65235908 (-) True G286953

Expression Profile


TU322065 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

TU322065 Expression in each Bioproject

Bar chart with 9 bars.
TU322065 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.