RNA id: TU333755



Basic Information


Item Value
RNA id TU333755
length 205
lncRNA type inter_gene
GC content 0.52
exon number 1
gene id G294272
representative True

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 72409933 ~ 72410137 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctactacaggacagtagctctccaggaacagggttggagggataacctacaggacagtagctctccaggaacagggttggagggataacctacagcacagtagctctccaggaacagggttggagggataacctactacaggacagtagctctccaggaacagggttggagggataacctactacagaacagtagctctccagga

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU333754 lncRNA downstream 1156 72408321 ~ 72408777 (-) True G294271
TU333751 lncRNA downstream 4984 72404667 ~ 72404949 (-) True G294268
TU333750 lncRNA downstream 6797 72402809 ~ 72403136 (-) True G294267
TU333742 lncRNA downstream 14297 72395288 ~ 72395636 (-) True G294259
TU333739 lncRNA downstream 17092 72392506 ~ 72392841 (-) True G294256
TU333775 lncRNA upstream 31621 72441758 ~ 72442130 (-) True G294292
TU333784 lncRNA upstream 41282 72451419 ~ 72451991 (-) True G294301
TU333787 lncRNA upstream 42789 72452926 ~ 72453189 (-) True G294304
TU333790 lncRNA upstream 44797 72454934 ~ 72455218 (-) True G294307
TU333794 lncRNA upstream 46570 72456707 ~ 72456935 (-) True G294310
XM_036975090.1 mRNA downstream 143283 72264378 ~ 72266650 (-) True LOC110520529
XM_036975087.1 mRNA downstream 203115 72121974 ~ 72206818 (-) False LOC110504660
XM_036975092.1 mRNA upstream 80711 72490848 ~ 72542128 (-) False LOC110520531
XM_036975091.1 mRNA upstream 83300 72493437 ~ 72537370 (-) False LOC110520531
LOC110504707 mRNA upstream 366579 72776716 ~ 72782874 (-) True LOC110504707
XM_036975102.1 mRNA upstream 381167 72791304 ~ 72825267 (-) False LOC110504714
XM_036975103.1 mRNA upstream 381167 72791304 ~ 72826819 (-) False LOC110504714
TU333434 other downstream 203135 72173049 ~ 72206798 (-) True LOC110504660
TU333405 other downstream 506025 71903314 ~ 71903908 (-) True G293984
TU332200 other downstream 1369781 71027619 ~ 71040152 (-) True G292919
TU332000 other downstream 1689342 70720036 ~ 70720591 (-) True G292753
TU331092 other downstream 2301983 70107540 ~ 70107950 (-) True G291977
TU333986 other upstream 161112 72571249 ~ 72575432 (-) True G294451
TU334284 other upstream 365270 72775407 ~ 72776607 (-) True G294697
TU334351 other upstream 466202 72876339 ~ 72880854 (-) True LOC110520539
TU335813 other upstream 1162155 73572292 ~ 73572911 (-) True G296011
TU335855 other upstream 1221901 73632038 ~ 73633036 (-) False G296043

Expression Profile


TU333755 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU333755 Expression in each Bioproject

Bar chart with 13 bars.
TU333755 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.