RNA id: TCONS_00030535



Basic Information


Item Value
RNA id TCONS_00030535
length 190
RNA type snoRNA
GC content 0.47
exon number 1
gene id XLOC_015216
representative True

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 7723394 ~ 7723583 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CCCTTCTTTTTAAAAAGCGCCATGCTAAAACCACCAGGTCGATGCTTTCGGGTCTCGCTCTGGTGTTCATGCTAGTACTGGTTAAATCACAAAGAAGGAAGAGCAAAAAGCACACAGTCGGAAATGAGTCTAGGACGGACCTCTTTCTTAATGTCCGGTGTCCGAGGTCTCAAGATTTTGTGCCACATGC

Function


GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDART00000119099

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00030530 lncRNA upstream 67 7715806 ~ 7723327 (+) False XLOC_015213
TCONS_00033473 lncRNA upstream 2681 7715792 ~ 7720713 (+) False XLOC_015213
TCONS_00033237 lncRNA upstream 61293 7657408 ~ 7662101 (+) True XLOC_015212
TCONS_00033472 lncRNA upstream 61896 7657298 ~ 7661498 (+) False XLOC_015212
TCONS_00033236 lncRNA upstream 68776 7647863 ~ 7654618 (+) True XLOC_015211
TCONS_00033474 lncRNA downstream 40324 7763907 ~ 7768273 (+) False XLOC_015218
TCONS_00033475 lncRNA downstream 40328 7763911 ~ 7768273 (+) True XLOC_015218
TCONS_00033476 lncRNA downstream 760811 8484394 ~ 8488138 (+) False XLOC_015225
TCONS_00033238 lncRNA downstream 761428 8485011 ~ 8488138 (+) False XLOC_015225
TCONS_00033239 lncRNA downstream 761457 8485040 ~ 8488138 (+) False XLOC_015225
TCONS_00030529 mRNA upstream 135734 7557912 ~ 7587660 (+) True XLOC_015209
TCONS_00030527 mRNA upstream 310813 7295515 ~ 7412581 (+) False XLOC_015205
TCONS_00030526 mRNA upstream 437085 7279646 ~ 7286309 (+) True XLOC_015204
TCONS_00030524 mRNA upstream 487100 7213146 ~ 7236294 (+) False XLOC_015202
TCONS_00030537 mRNA downstream 94785 7818368 ~ 7829400 (+) True XLOC_015219
TCONS_00030538 mRNA downstream 123897 7847480 ~ 7874075 (+) False XLOC_015220
TCONS_00030539 mRNA downstream 126307 7849890 ~ 7869613 (+) False XLOC_015220
TCONS_00030540 mRNA downstream 127910 7851493 ~ 7874384 (+) True XLOC_015220
TCONS_00030541 mRNA downstream 307651 8031234 ~ 8050498 (+) False XLOC_015221
TCONS_00030534 other upstream 2004 7721212 ~ 7721390 (+) True XLOC_015215
TCONS_00030533 other upstream 2385 7720939 ~ 7721009 (+) True XLOC_015214
TCONS_00030532 other upstream 2765 7720559 ~ 7720629 (+) True XLOC_015213
TCONS_00030528 other upstream 328486 7394790 ~ 7394908 (+) True XLOC_015206
TCONS_00030520 other upstream 585314 7132281 ~ 7138080 (+) False XLOC_015199
TCONS_00030536 other downstream 287 7723870 ~ 7723941 (+) True XLOC_015217
TCONS_00030543 other downstream 321833 8045416 ~ 8047257 (+) True XLOC_015221
TCONS_00030545 other downstream 465702 8189285 ~ 8189400 (+) True XLOC_015223
TCONS_00030568 other downstream 2107755 9831338 ~ 9833806 (+) False XLOC_015238
TCONS_00030569 other downstream 2114449 9838032 ~ 9841864 (+) False XLOC_015238

Expression Profile


Expression of TCONS_00030535 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.
//

Expression of TCONS_00030535 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.