RNA id: TU370247



Basic Information


Item Value
RNA id TU370247
length 288
lncRNA type intronic
GC content 0.45
exon number 2
gene id G327013
representative True

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 17073302 ~ 17099998 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctgtgattattattggaccctgctggtcatctatgaacatttgaacatctggccttaatggccatgtactcttataatctccatccggcacagccagaagaggactggccacccttcagagcctggttcctctctaggtttcttcctaggttttggcctttctagggagtttttcctagccaccgtgcttctacacctgcattgcttgctgtttggggttttaggctgggtttctgtacagcactttgagatatcagctgatataagaagggctatataaatacattt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU369644 lncRNA downstream 52268 17020770 ~ 17021034 (-) True G326465
TU369574 lncRNA downstream 136094 16936796 ~ 16937208 (-) True G326395
TU369343 lncRNA downstream 263859 16809145 ~ 16809443 (-) True G326166
TU369341 lncRNA downstream 265904 16806500 ~ 16807398 (-) True G326164
TU369338 lncRNA downstream 267640 16805408 ~ 16805662 (-) True G326161
TU370350 lncRNA upstream 140393 17240391 ~ 17250692 (-) True G327105
TU370367 lncRNA upstream 162054 17262052 ~ 17269458 (-) False LOC110522210
TU370368 lncRNA upstream 162054 17262052 ~ 17269458 (-) False LOC110522210
TU370369 lncRNA upstream 164414 17264412 ~ 17269458 (-) False LOC110522210
TU370370 lncRNA upstream 164414 17264412 ~ 17269458 (-) False LOC110522210
XM_021600407.2 mRNA downstream 405249 16665910 ~ 16668053 (-) True hsdl1
XM_021600399.2 mRNA downstream 407977 16663179 ~ 16665325 (-) True gja11
XM_021600400.2 mRNA downstream 410381 16660751 ~ 16662921 (-) True gja13.2
XM_021600402.2 mRNA downstream 413438 16656912 ~ 16659864 (-) True LOC110522204
LOC110522201 mRNA downstream 425720 16645396 ~ 16647582 (-) True LOC110522201
XR_002473268.2 mRNA upstream 162286 17262284 ~ 17269513 (-) False LOC110522210
XR_002473269.2 mRNA upstream 162286 17262284 ~ 17269519 (-) False LOC110522210
XM_021600416.2 mRNA upstream 162286 17262284 ~ 17269520 (-) False LOC110522210
LOC110521050 mRNA upstream 196312 17296310 ~ 17309948 (-) True LOC110521050
XM_021600420.2 mRNA upstream 212508 17312506 ~ 17404795 (-) False slc35f1
TU369118 other downstream 410421 16646755 ~ 16662881 (-) True G325960
TU368823 other downstream 732595 16339332 ~ 16340707 (-) True G325696
TU368604 other downstream 968614 16019428 ~ 16104688 (-) True rnf217
TU367449 other downstream 1818294 15253864 ~ 15255008 (-) True G324432
TU366076 other downstream 2886131 14128489 ~ 14187171 (-) True G323167
TU370509 other upstream 462872 17562870 ~ 17566147 (-) True vgll2a
TU370698 other upstream 695192 17795190 ~ 17800469 (-) True G327409
TU371042 other upstream 1183779 18283777 ~ 18285410 (-) True LOC110522229
TU371579 other upstream 1346585 18446583 ~ 18447030 (-) True G328236
TU372144 other upstream 1695108 18795106 ~ 18862375 (-) False G328760

Expression Profile


TU370247 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU370247 Expression in each Bioproject

Bar chart with 19 bars.
TU370247 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.