RNA id: TCONS_00030568



Basic Information


Item Value
RNA id TCONS_00030568
length 458
RNA type processed_transcript
GC content 0.43
exon number 3
gene id XLOC_015238
representative False

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 9821757 ~ 9842240 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GCAAAAGTAGTTCCTCAAAATGACATTCATATTATGTATGAGGTTGTACTTTTTTAGTGGTTCTGAAGTAGTTATTGATTCAAAATAAGTTTCTATTTTTGGCAAAGCCATTGTGGATCACCTCACATCTAAATGAGTCTGTTTTCTTTTGGTTTGTGGTCACATTGTTGGAGGAGTTGGAGGAAGTCTTGAAGAATGAGCTGACAGGAAACTTTGAGAACGCAGTTATAGCCATGCTGGACCCGCCCAACGTCTTCATGGCTAAAGAGCTGAGGAGAGCCATGAAGGGTGCTGGGACAGATGAGGACGTGCTGGTGGAGATCCTCTGCACCAGCACCAATCAGGATATTTTGAATTACAAAGAGGCATATCTGCAAGTTCATGAGCGAGATTTGGAGGCTGATATCGAAGATGACACCAGTGGTGAAGTGAGGAATCTGCTGGTTTCTCTCCTACAG

Function


GO:

id name namespace
GO:0005737 cytoplasm cellular_component
GO:0005509 calcium ion binding molecular_function
GO:0005544 calcium-dependent phospholipid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-310 Predicted to enable calcium ion binding activity. Predicted to be active in cytoplasm. Is expressed in basal plate midbrain region and nervous system.

Ensembl:

ensembl_id ENSDART00000141472

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00033480 lncRNA upstream 174291 9651716 ~ 9657047 (+) False XLOC_015236
TCONS_00033481 lncRNA upstream 174291 9652000 ~ 9657047 (+) False XLOC_015236
TCONS_00033483 lncRNA upstream 174291 9652353 ~ 9657047 (+) False XLOC_015236
TCONS_00033482 lncRNA upstream 174291 9652353 ~ 9657047 (+) False XLOC_015236
TCONS_00033485 lncRNA upstream 174291 9652382 ~ 9657047 (+) False XLOC_015236
TCONS_00030570 lncRNA downstream 4265 9838071 ~ 9838649 (+) True XLOC_015238
TCONS_00033487 lncRNA downstream 450955 10284761 ~ 10285629 (+) True XLOC_015251
TCONS_00030592 lncRNA downstream 552673 10386479 ~ 10416272 (+) True XLOC_015252
TCONS_00033488 lncRNA downstream 729693 10563499 ~ 10564386 (+) True XLOC_015253
TCONS_00033489 lncRNA downstream 770707 10604513 ~ 10607329 (+) True XLOC_015254
TCONS_00030560 mRNA upstream 51379 9755422 ~ 9779959 (+) False XLOC_015237
TCONS_00030561 mRNA upstream 51815 9757453 ~ 9779523 (+) True XLOC_015237
TCONS_00030559 mRNA upstream 240488 9560740 ~ 9590850 (+) True XLOC_015235
TCONS_00030558 mRNA upstream 271031 9552456 ~ 9560307 (+) True XLOC_015234
TCONS_00030557 mRNA upstream 272423 9536021 ~ 9558915 (+) True XLOC_015233
TCONS_00030572 mRNA downstream 84872 9918678 ~ 9941230 (+) False XLOC_015240
TCONS_00030573 mRNA downstream 85129 9918935 ~ 9941405 (+) True XLOC_015240
TCONS_00030574 mRNA downstream 112315 9946121 ~ 9957805 (+) True XLOC_015241
TCONS_00030575 mRNA downstream 137136 9970942 ~ 9982960 (+) False XLOC_015242
TCONS_00030576 mRNA downstream 139881 9973687 ~ 9983661 (+) False XLOC_015242
TCONS_00030545 other upstream 1641938 8189285 ~ 8189400 (+) True XLOC_015223
TCONS_00030543 other upstream 1784081 8045416 ~ 8047257 (+) True XLOC_015221
TCONS_00030536 other upstream 2107397 7723870 ~ 7723941 (+) True XLOC_015217
TCONS_00030535 other upstream 2107755 7723394 ~ 7723583 (+) True XLOC_015216
TCONS_00030534 other upstream 2109948 7721212 ~ 7721390 (+) True XLOC_015215
TCONS_00030569 other downstream 4226 9838032 ~ 9841864 (+) False XLOC_015238
TCONS_00030571 other downstream 41723 9875529 ~ 9875645 (+) True XLOC_015239
TCONS_00030577 other downstream 140075 9973881 ~ 9982953 (+) True XLOC_015242
TCONS_00030590 other downstream 372195 10206001 ~ 10206118 (+) True XLOC_015249
TCONS_00030605 other downstream 1172851 11006657 ~ 11006790 (+) True XLOC_015261

Expression Profile


Expression of TCONS_00030568 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.
//

Expression of TCONS_00030568 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.