RNA id: TCONS_00030570



Basic Information


Item Value
RNA id TCONS_00030570
length 404
lncRNA type retained_intron
GC content 0.44
exon number 2
gene id XLOC_015238
representative True

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 9821757 ~ 9842240 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ATATCTTTTTTAAACAGACCTGACCATCACCGTTATTATGCTAATTAAAAGAATCAGTACCTGTTGTTATTTTTCTTCAGGCAGGTGAAGGCCGCTTTGGCACAGACGAGTCCACTTTCACCTACATCCTCACTCACAGGAACTACCTACAGCTTCAGGCCACCTTCAAGATATATGAAACCGTATGCTATACACCAACTACACCCACTGCTGCTTTACAAGAGCCGTTTGAGGCATTCTGTTTGAGTGTCTGGTTTCCCTTTTGTTGTCTTCGCATAGCTCTCTGGAACAGATATTCTGGATGCTATAGACAGTGAGGCTACAGGAACATTGAAGGACTGTTACGTTACACTGGTACGATGTGCTAAAAACCCACAGCTGTATTTTGCCCGTCGTCTGAACGC

Function


GO:

id name namespace
GO:0005737 cytoplasm cellular_component
GO:0005509 calcium ion binding molecular_function
GO:0005544 calcium-dependent phospholipid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-310 Predicted to enable calcium ion binding activity. Predicted to be active in cytoplasm. Is expressed in basal plate midbrain region and nervous system.

Ensembl:

ensembl_id ENSDART00000139639

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00033480 lncRNA upstream 181024 9651716 ~ 9657047 (+) False XLOC_015236
TCONS_00033481 lncRNA upstream 181024 9652000 ~ 9657047 (+) False XLOC_015236
TCONS_00033483 lncRNA upstream 181024 9652353 ~ 9657047 (+) False XLOC_015236
TCONS_00033482 lncRNA upstream 181024 9652353 ~ 9657047 (+) False XLOC_015236
TCONS_00033485 lncRNA upstream 181024 9652382 ~ 9657047 (+) False XLOC_015236
TCONS_00033487 lncRNA downstream 446112 10284761 ~ 10285629 (+) True XLOC_015251
TCONS_00030592 lncRNA downstream 547830 10386479 ~ 10416272 (+) True XLOC_015252
TCONS_00033488 lncRNA downstream 724850 10563499 ~ 10564386 (+) True XLOC_015253
TCONS_00033489 lncRNA downstream 765864 10604513 ~ 10607329 (+) True XLOC_015254
TCONS_00030612 lncRNA downstream 1216667 11055316 ~ 11063844 (+) True XLOC_015262
TCONS_00030564 mRNA upstream 1833 9821782 ~ 9836238 (+) False XLOC_015238
TCONS_00030560 mRNA upstream 58112 9755422 ~ 9779959 (+) False XLOC_015237
TCONS_00030561 mRNA upstream 58548 9757453 ~ 9779523 (+) True XLOC_015237
TCONS_00030559 mRNA upstream 247221 9560740 ~ 9590850 (+) True XLOC_015235
TCONS_00030558 mRNA upstream 277764 9552456 ~ 9560307 (+) True XLOC_015234
TCONS_00030572 mRNA downstream 80029 9918678 ~ 9941230 (+) False XLOC_015240
TCONS_00030573 mRNA downstream 80286 9918935 ~ 9941405 (+) True XLOC_015240
TCONS_00030574 mRNA downstream 107472 9946121 ~ 9957805 (+) True XLOC_015241
TCONS_00030575 mRNA downstream 132293 9970942 ~ 9982960 (+) False XLOC_015242
TCONS_00030576 mRNA downstream 135038 9973687 ~ 9983661 (+) False XLOC_015242
TCONS_00030568 other upstream 4265 9831338 ~ 9833806 (+) False XLOC_015238
TCONS_00030545 other upstream 1648671 8189285 ~ 8189400 (+) True XLOC_015223
TCONS_00030543 other upstream 1790814 8045416 ~ 8047257 (+) True XLOC_015221
TCONS_00030536 other upstream 2114130 7723870 ~ 7723941 (+) True XLOC_015217
TCONS_00030535 other upstream 2114488 7723394 ~ 7723583 (+) True XLOC_015216
TCONS_00030571 other downstream 36880 9875529 ~ 9875645 (+) True XLOC_015239
TCONS_00030577 other downstream 135232 9973881 ~ 9982953 (+) True XLOC_015242
TCONS_00030590 other downstream 367352 10206001 ~ 10206118 (+) True XLOC_015249
TCONS_00030605 other downstream 1168008 11006657 ~ 11006790 (+) True XLOC_015261
TCONS_00030617 other downstream 1405237 11243886 ~ 11244007 (+) True XLOC_015265

Expression Profile


Expression of TCONS_00030570 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.
//

Expression of TCONS_00030570 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.