RNA id: TCONS_00030584


Basic Information

Item Value
RNA id TCONS_00030584
length 374
RNA type mRNA
GC content 0.51
exon number 2
gene id XLOC_015245
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 10127762 ~ 10129061 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAGCTTACAAAAGGTTTGGGCAGTAGACTTTTCTTACTCTTTCCAGTCATGAAGGTGATGCTGCTAGCAGTGCTGTTGGTGTTTGCTGCATGTGCAGATTCGGCTCAGGCACAGAAAGGTCTCCGACTCTGTGGCCGTGAGTTTTTTCGGGCCGTCGTCTACACGTGTGGGGGCTCCAGATGGAGGCGGGTCCAAACTGAAGACCCCGTAAATGGTTATGAAATCGAGGCTGATGTGGAGTCACTAACCTCTGCAGAAATGGACCGAGAAAGAAGAGAGGTGTACGAAACGCTGCCTTCCACCTGCTGTAAAGTGGGCTGTAGAAAAAGCGATCTAGTTCGCATGTGCTGAGAAGCACAGGACTCCAGCACTTT

Function

GO:

id name namespace
GO:0005576 extracellular region cellular_component
GO:0005179 hormone activity molecular_function
GO:0001664 G protein-coupled receptor binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070122-5 Predicted to enable G protein-coupled receptor binding activity. Predicted to be located in extracellular region. Is expressed in several structures, including enteroendocrine cell; female organism; gonad; gut; and male organism. Orthologous to human INSL5 (insulin like 5).

Ensembl:

ensembl_id ENSDART00000100726

JBrowse2

Loading

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00030570 lncRNA upstream 289113 9838071 ~ 9838649 (+) True XLOC_015238
TCONS_00033482 lncRNA upstream 470715 9652353 ~ 9657047 (+) False XLOC_015236
TCONS_00033487 lncRNA downstream 155700 10284761 ~ 10285629 (+) True XLOC_015251
TCONS_00030592 lncRNA downstream 257418 10386479 ~ 10416272 (+) True XLOC_015252
TCONS_00033488 lncRNA downstream 434438 10563499 ~ 10564386 (+) True XLOC_015253
TCONS_00033489 lncRNA downstream 475452 10604513 ~ 10607329 (+) True XLOC_015254
TCONS_00030612 lncRNA downstream 926255 11055316 ~ 11063844 (+) True XLOC_015262
TCONS_00030582 mRNA upstream 50833 10063765 ~ 10076929 (+) False XLOC_015244
TCONS_00030581 mRNA upstream 51537 10063747 ~ 10076225 (+) False XLOC_015244
TCONS_00030583 mRNA upstream 51537 10063792 ~ 10076225 (+) True XLOC_015244
TCONS_00030578 mRNA upstream 87498 9990491 ~ 10040264 (+) False XLOC_015243
TCONS_00030579 mRNA upstream 87972 10006839 ~ 10039790 (+) False XLOC_015243
TCONS_00030585 mRNA downstream 5284 10134345 ~ 10141741 (+) True XLOC_015246
TCONS_00030586 mRNA downstream 17968 10147029 ~ 10151455 (+) False XLOC_015247
TCONS_00030587 mRNA downstream 18042 10147103 ~ 10151839 (+) False XLOC_015247
TCONS_00030588 mRNA downstream 18062 10147123 ~ 10150150 (+) True XLOC_015247
TCONS_00030589 mRNA downstream 31423 10160484 ~ 10169433 (+) True XLOC_015248
TCONS_00030577 other upstream 144809 9973881 ~ 9982953 (+) True XLOC_015242
TCONS_00030571 other upstream 252117 9875529 ~ 9875645 (+) True XLOC_015239
TCONS_00030569 other upstream 285898 9838032 ~ 9841864 (+) False XLOC_015238
TCONS_00030568 other upstream 293956 9831338 ~ 9833806 (+) False XLOC_015238
TCONS_00030545 other upstream 1938362 8189285 ~ 8189400 (+) True XLOC_015223
TCONS_00030590 other downstream 76940 10206001 ~ 10206118 (+) True XLOC_015249
TCONS_00030605 other downstream 877596 11006657 ~ 11006790 (+) True XLOC_015261
TCONS_00030617 other downstream 1114825 11243886 ~ 11244007 (+) True XLOC_015265
TCONS_00030621 other downstream 1627863 11756924 ~ 11764998 (+) False XLOC_015269
TCONS_00030632 other downstream 2247761 12376822 ~ 12378603 (+) False XLOC_015273

Expression Profile

Expression of TCONS_00030584 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.
//

Expression of TCONS_00030584 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) TU29027 True 693 TUCP 0.39 2 CI01000004 1773040 ~ 1774941 (-)