RNA id: TCONS_00031082


Basic Information

Item Value
RNA id TCONS_00031082
length 394
RNA type processed_transcript
GC content 0.51
exon number 3
gene id XLOC_015548
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 31271082 ~ 31364659 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACACAACAAAGGAAGGAGCCCTAACATATGACAGGGGGACCTCCTATATATGCATAAGCAACTGGGTGTGATCATGTGACTGGATGCCAGACTGTGACAGGCACGGGCCCCAGGTGTGAACATGAAAGCCTGATTTGATTAACTTTTAGGGAGGGATTGACCCCTCATTTATGTGTGGATGTTCCGGGCCCCTAGCATGGACCCACAAACCCGCAAGTTGAGCCGCTCAGAGCAAGATGCCTTGGAGCAGCGTTCTTGTTGAAGTCACTTGTCCCACCGTGGATTATTGTTGAAGAATTCTGCGCAGGAGATTGAGGCTTGACTATGGGCTGTGTCAAGAGTAAAGAGGACAAGGGTCCCACACAGAAGTACCGACCAGATCCCACCAATCCC

Function

GO:

id name namespace
GO:0005615 extracellular space cellular_component
GO:0005634 nucleus cellular_component
GO:0051787 misfolded protein binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-031118-57 Predicted to enable misfolded protein binding activity. Predicted to be located in extracellular region. Predicted to be active in extracellular space and nucleus. Is expressed in cranial blood vessel and photoreceptor cell. Orthologous to human CLUL1 (clusterin like 1).

Ensembl:

ensembl_id ENSDART00000143794

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033271 lncRNA upstream 53304 31100444 ~ 31217778 (+) False XLOC_015545
TCONS_00031077 lncRNA upstream 138420 31100444 ~ 31132662 (+) False XLOC_015545
TCONS_00031081 lncRNA upstream 138420 31112476 ~ 31132662 (+) True XLOC_015545
TCONS_00031080 lncRNA upstream 155188 31112476 ~ 31115894 (+) False XLOC_015545
TCONS_00033270 lncRNA upstream 187002 31075576 ~ 31084080 (+) True XLOC_015544
TCONS_00031088 lncRNA downstream 117498 31448456 ~ 31449414 (+) True XLOC_015551
TCONS_00031093 lncRNA downstream 172347 31503305 ~ 31511614 (+) True XLOC_015553
TCONS_00033557 lncRNA downstream 206380 31537338 ~ 31540590 (+) True XLOC_015554
TCONS_00031101 lncRNA downstream 453054 31784012 ~ 31786282 (+) True XLOC_015559
TCONS_00033558 lncRNA downstream 535541 31866499 ~ 31868755 (+) True XLOC_015564
TCONS_00031075 mRNA upstream 286574 30960351 ~ 30984508 (+) False XLOC_015543
TCONS_00031076 mRNA upstream 288556 30969029 ~ 30982526 (+) True XLOC_015543
TCONS_00031071 mRNA upstream 311169 30916188 ~ 30959913 (+) False XLOC_015542
TCONS_00031073 mRNA upstream 318004 30948503 ~ 30953078 (+) False XLOC_015542
TCONS_00031069 mRNA upstream 362782 30904069 ~ 30908300 (+) True XLOC_015541
TCONS_00031086 mRNA downstream 51632 31382590 ~ 31435158 (+) True XLOC_015550
TCONS_00031087 mRNA downstream 106589 31437547 ~ 31452606 (+) False XLOC_015551
TCONS_00031089 mRNA downstream 123604 31454562 ~ 31457860 (+) True XLOC_015552
TCONS_00031090 mRNA downstream 144814 31475772 ~ 31511986 (+) False XLOC_015553
TCONS_00031091 mRNA downstream 145107 31476065 ~ 31519662 (+) False XLOC_015553
TCONS_00031079 other upstream 162668 31107929 ~ 31108414 (+) True XLOC_015547
TCONS_00031078 other upstream 169509 31101088 ~ 31101573 (+) True XLOC_015546
TCONS_00031072 other upstream 344778 30916200 ~ 30926304 (+) False XLOC_015542
TCONS_00031070 other upstream 349606 30916188 ~ 30921476 (+) False XLOC_015542
TCONS_00031062 other upstream 438107 30786783 ~ 30832975 (+) False XLOC_015538
TCONS_00031110 other downstream 611501 31942459 ~ 31948455 (+) False XLOC_015565
TCONS_00031118 other downstream 1273889 32604847 ~ 32608027 (+) False XLOC_015571
TCONS_00031119 other downstream 1370862 32701820 ~ 32703332 (+) False XLOC_015574
TCONS_00031120 other downstream 1370893 32701851 ~ 32707411 (+) True XLOC_015574
TCONS_00031122 other downstream 1427705 32758663 ~ 32760332 (+) True XLOC_015576

Expression Profile

//