RNA id: TCONS_00031088


Basic Information

Item Value
RNA id TCONS_00031088
length 552
lncRNA type retained_intron
GC content 0.48
exon number 5
gene id XLOC_015551
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 31437547 ~ 31452606 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTGCAGTTTAGTGAAGAAGTCCAAGTAGAGACGATTGAACCAGAACCAGAGCCTGCCTACATTGATGAGGAGAAAATGGACCAGCTGCTTCAGATGATCCAGAGTGCAGACCCGACAGATGACCAGTCAGACACCTGTGAGCTCCTACAGTTGGAGGCTGCTTGCAACCAGATGGGTCCTCTCATTGATCAGAAGCTGGAAGACACTGACAGGAAACACTCAGAGCTGTCTGAGCTGAACGTGAAGGTCATGGAAGCTCTGTCTCTCTATGCTAAGCTAATGAATGAAGACCCAGTATACGCTATGTATGCCAAACTACAGAGCCAGCAATACTACATGCAGCAGGCCCCAAACTCTTCCCAACAGGTGTACCCTGGACAGTCCACTGGAGGGCAGTATGCAATGGGAAGCACAGCAGTACCAGGATACAACGTTCCAATGGAGCAGCTTACTGCAATGAACCAAGCAGGAACACCAATGGCAGGGCAGCCTACTCCTAGGTGTGCACAATGAATTATATTTCACACATTAATAAAGTGGTTAATATTGTTT

Function

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway biological_process
GO:0033565 ESCRT-0 complex cellular_component

KEGG:

id description
ko04630 JAK-STAT signaling pathway
ko04144 Endocytosis
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-031118-123 Predicted to be involved in protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway. Predicted to act upstream of or within intracellular protein transport. Predicted to be located in early endosome membrane. Predicted to be part of ESCRT-0 complex. Is expressed in immature eye and nervous system. Orthologous to human STAM (signal transducing adaptor molecule).

Ensembl:

ensembl_id ENSDART00000142727

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033555 lncRNA upstream 103260 31271082 ~ 31345196 (+) False XLOC_015548
TCONS_00033556 lncRNA upstream 155853 31291646 ~ 31292603 (+) True XLOC_015549
TCONS_00033271 lncRNA upstream 230678 31100444 ~ 31217778 (+) False XLOC_015545
TCONS_00031077 lncRNA upstream 315794 31100444 ~ 31132662 (+) False XLOC_015545
TCONS_00031081 lncRNA upstream 315794 31112476 ~ 31132662 (+) True XLOC_015545
TCONS_00031093 lncRNA downstream 53891 31503305 ~ 31511614 (+) True XLOC_015553
TCONS_00033557 lncRNA downstream 87924 31537338 ~ 31540590 (+) True XLOC_015554
TCONS_00031101 lncRNA downstream 334598 31784012 ~ 31786282 (+) True XLOC_015559
TCONS_00033558 lncRNA downstream 417085 31866499 ~ 31868755 (+) True XLOC_015564
TCONS_00031106 lncRNA downstream 492976 31942390 ~ 31948455 (+) False XLOC_015565
TCONS_00031086 mRNA upstream 13298 31382590 ~ 31435158 (+) True XLOC_015550
TCONS_00031084 mRNA upstream 83797 31330358 ~ 31364659 (+) False XLOC_015548
TCONS_00031083 mRNA upstream 85049 31308587 ~ 31363407 (+) False XLOC_015548
TCONS_00031075 mRNA upstream 463948 30960351 ~ 30984508 (+) False XLOC_015543
TCONS_00031076 mRNA upstream 465930 30969029 ~ 30982526 (+) True XLOC_015543
TCONS_00031089 mRNA downstream 5148 31454562 ~ 31457860 (+) True XLOC_015552
TCONS_00031090 mRNA downstream 26358 31475772 ~ 31511986 (+) False XLOC_015553
TCONS_00031091 mRNA downstream 26651 31476065 ~ 31519662 (+) False XLOC_015553
TCONS_00031092 mRNA downstream 43248 31492662 ~ 31507885 (+) False XLOC_015553
TCONS_00031094 mRNA downstream 148427 31597841 ~ 31607080 (+) False XLOC_015555
TCONS_00031085 other upstream 103260 31330923 ~ 31345196 (+) True XLOC_015548
TCONS_00031082 other upstream 117498 31271082 ~ 31330958 (+) False XLOC_015548
TCONS_00031079 other upstream 340042 31107929 ~ 31108414 (+) True XLOC_015547
TCONS_00031078 other upstream 346883 31101088 ~ 31101573 (+) True XLOC_015546
TCONS_00031072 other upstream 522152 30916200 ~ 30926304 (+) False XLOC_015542
TCONS_00031110 other downstream 493045 31942459 ~ 31948455 (+) False XLOC_015565
TCONS_00031118 other downstream 1155433 32604847 ~ 32608027 (+) False XLOC_015571
TCONS_00031119 other downstream 1252406 32701820 ~ 32703332 (+) False XLOC_015574
TCONS_00031120 other downstream 1252437 32701851 ~ 32707411 (+) True XLOC_015574
TCONS_00031122 other downstream 1309249 32758663 ~ 32760332 (+) True XLOC_015576

Expression Profile

//