RNA id: TCONS_00031420



Basic Information


Item Value
RNA id TCONS_00031420
length 243
RNA type mRNA
GC content 0.50
exon number 2
gene id XLOC_015805
representative False

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 42715995 ~ 42722040 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ATGGCAGAATCCACACTTTCCTTGGCTCAGGATCAGTTCAACTGTTCCCTCTGTTTGGAGCTGCTAAAGGATTCAGTGGCCATTCCCTGTGGACACAGTTACTGTATGAGCTGTATTTCAGACTGCTGGGATCAGGATGAGCAGAAGGGAGTCTACAGCTGCCCTCAGTGCAGACAGACCTTCACTCCAAGACCTGCTTTAGGGAAAAACACCATGCTGACTGAAGTTGAGGAGAGACGCTGA

Function


GO:

id name namespace
GO:0046872 metal ion binding molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-196 Predicted to enable zinc ion binding activity. Is expressed in gill; liver; muscle; and pleuroperitoneal region.

Ensembl:

ensembl_id ENSDART00000183914

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00033296 lncRNA upstream 70001 42645388 ~ 42645994 (+) True XLOC_015803
TCONS_00033640 lncRNA upstream 91105 42616861 ~ 42624890 (+) True XLOC_015802
TCONS_00033638 lncRNA upstream 293351 42410888 ~ 42422644 (+) False XLOC_015798
TCONS_00033639 lncRNA upstream 293351 42419803 ~ 42422644 (+) True XLOC_015798
TCONS_00031392 lncRNA upstream 533615 42176922 ~ 42182380 (+) False XLOC_015787
TCONS_00031425 lncRNA downstream 56138 42773349 ~ 42774516 (+) False XLOC_015807
TCONS_00031426 lncRNA downstream 56173 42773384 ~ 42781254 (+) True XLOC_015807
TCONS_00033641 lncRNA downstream 255716 42972927 ~ 43010381 (+) True XLOC_015809
TCONS_00033642 lncRNA downstream 421344 43138555 ~ 43163518 (+) True XLOC_015811
TCONS_00033644 lncRNA downstream 936409 43653620 ~ 43659284 (+) False XLOC_015814
TCONS_00031418 mRNA upstream 2093 42708684 ~ 42713902 (+) True XLOC_015804
TCONS_00031417 mRNA upstream 5789 42708674 ~ 42710206 (+) False XLOC_015804
TCONS_00031415 mRNA upstream 115882 42592572 ~ 42600113 (+) False XLOC_015801
TCONS_00031416 mRNA upstream 115908 42592851 ~ 42600087 (+) True XLOC_015801
TCONS_00031412 mRNA upstream 370424 42344304 ~ 42345571 (+) True XLOC_015797
TCONS_00031424 mRNA downstream 7193 42724404 ~ 42748657 (+) True XLOC_015806
TCONS_00031427 mRNA downstream 154620 42871831 ~ 42936509 (+) False XLOC_015808
TCONS_00031428 mRNA downstream 155450 42872661 ~ 42926323 (+) True XLOC_015808
TCONS_00031430 mRNA downstream 487708 43204919 ~ 43388816 (+) False XLOC_015812
TCONS_00031431 mRNA downstream 487766 43204977 ~ 43330059 (+) False XLOC_015812
TCONS_00031414 other upstream 128960 42586738 ~ 42587035 (+) True XLOC_015800
TCONS_00031413 other upstream 292196 42423684 ~ 42423799 (+) True XLOC_015799
TCONS_00031377 other upstream 1679804 41036076 ~ 41036191 (+) True XLOC_015775
TCONS_00031374 other upstream 2658979 40056899 ~ 40057016 (+) True XLOC_015768
TCONS_00031335 other upstream 4837691 37874771 ~ 37878304 (+) False XLOC_015735
TCONS_00031429 other downstream 281591 42998802 ~ 42998919 (+) True XLOC_015810
TCONS_00031434 other downstream 562390 43279601 ~ 43303082 (+) True XLOC_015812
TCONS_00031447 other downstream 1635462 44352673 ~ 44353567 (+) False XLOC_015820
TCONS_00031458 other downstream 1847167 44564378 ~ 44564494 (+) True XLOC_015827
TCONS_00031468 other downstream 2206588 44923799 ~ 44924676 (+) True XLOC_015830

Expression Profile


//