RNA id: TU475011



Basic Information


Item Value
RNA id TU475011
length 338
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G419116
representative True

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 57334622 ~ 57334959 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atacatgaataaactaacaaaacaataaacgtgcgaaaacctaaacagcctatctggtgacaacaaacacaaagacaggaacaatcacccacgaaacactcaaagaatatggctgcctaaatatggttcccaatcagagacaacgataaacacctgcctctgattgagaaccactccagacagccttagactatgctagatacccccactaagccacaaacccaatacctaacaaaaccccaagacaaaacacaccacataaaaaaaccatgtcacaccctggcctgaccaaataaataaagaaaacacaaaatactaagaccagggcgtgacagaac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU474950 lncRNA downstream 79867 57246557 ~ 57254755 (-) True G419056
TU474929 lncRNA downstream 84068 57212400 ~ 57250554 (-) True G419039
TU474894 lncRNA downstream 168044 57166334 ~ 57166578 (-) True G419006
TU474881 lncRNA downstream 181610 57152803 ~ 57153012 (-) True G418993
TU474870 lncRNA downstream 196537 57137844 ~ 57138085 (-) True G418982
TU475012 lncRNA upstream 411 57335370 ~ 57335571 (-) True G419117
TU475020 lncRNA upstream 8655 57343614 ~ 57343930 (-) True G419125
TU475036 lncRNA upstream 18989 57353948 ~ 57354150 (-) True G419140
TU475039 lncRNA upstream 23369 57358328 ~ 57358619 (-) True G419143
TU475040 lncRNA upstream 24895 57359854 ~ 57360178 (-) True G419144
XM_021603466.2 mRNA downstream 219757 57078575 ~ 57114865 (-) True apc2
XM_021603459.2 mRNA downstream 318682 57011622 ~ 57015940 (-) True LOC110524110
XM_036977928.1 mRNA downstream 323221 57007649 ~ 57011401 (-) True LOC110524111
XM_021603455.2 mRNA downstream 332598 56985006 ~ 57002024 (-) False LOC110524108
XM_021603472.2 mRNA upstream 14011 57348970 ~ 57351000 (-) True LOC110524120
XM_036977939.1 mRNA upstream 109217 57444176 ~ 57457620 (-) False LOC110524122
XM_021603475.2 mRNA upstream 109217 57444176 ~ 57459501 (-) False LOC110524122
XM_036977940.1 mRNA upstream 125205 57460164 ~ 57537912 (-) False LOC110524123
XM_036977941.1 mRNA upstream 125205 57460164 ~ 57537912 (-) False LOC110524123
TU474707 other downstream 500027 56834026 ~ 56834595 (-) True G418830
TU474560 other downstream 623238 56710280 ~ 56711384 (-) True LOC110522975
TU474559 other downstream 624782 56708798 ~ 56709840 (-) False LOC110522975
TU473281 other downstream 1724892 55608835 ~ 55609730 (-) True G417527
TU472396 other downstream 2174355 55141315 ~ 55160267 (-) True LOC110524071
TU475541 other upstream 276100 57611059 ~ 57611567 (-) True G419603
TU475533 other upstream 285095 57620054 ~ 57626174 (-) True LOC110524128
TU475656 other upstream 364786 57699745 ~ 57705936 (-) True G419714
TU476193 other upstream 777428 58112387 ~ 58114060 (-) True G420193
TU476443 other upstream 1078169 58413128 ~ 58414143 (-) True G420421

Expression Profile


TU475011 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU475011 Expression in each Bioproject

Bar chart with 19 bars.
TU475011 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.