RNA id: TU480894



Basic Information


Item Value
RNA id TU480894
length 375
RNA type TUCP
GC content 0.56
exon number 1
gene id G424474
representative True

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 61616870 ~ 61617244 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ggcgcgaaggacgggcttgatgcaggagacatggaagaccgggtggacgcgacgaaggtatcgcggaagaagaagtcgaactgcgacaggattaatgacccgagaaatacggaacggaccaatgaaccgcggggtcaacttgcgagaagccgtcttaaggagaaggttctgagtggagagccaaactctctgaccgcgacaatatctaggactcttagttctacgcttattagcagccctcacagtctgcgccctataacggcaaagtgcagacctgaccctcttccaggtgcgctcgcaacgttggacaaaagcctgagcggaggggacgctggactcggcgaactgagatgagaacagcggaggctggtaccc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU480891 lncRNA downstream 5300 61611298 ~ 61611570 (-) True G424471
TU480887 lncRNA downstream 9407 61603707 ~ 61607463 (-) True G424467
TU480884 lncRNA downstream 14596 61601882 ~ 61602274 (-) True G424464
TU480883 lncRNA downstream 15177 61601272 ~ 61601693 (-) True G424463
TU480882 lncRNA downstream 15758 61600754 ~ 61601112 (-) True G424462
TU480895 lncRNA upstream 809 61618053 ~ 61618741 (-) True LOC110524247
TU480903 lncRNA upstream 11032 61628276 ~ 61628498 (-) True G424483
TU480907 lncRNA upstream 19869 61637113 ~ 61637366 (-) True G424487
TU480917 lncRNA upstream 32204 61649448 ~ 61649651 (-) True G424497
TU480921 lncRNA upstream 34778 61652022 ~ 61652284 (-) True G424500
XM_036978016.1 mRNA downstream 105792 61304113 ~ 61511078 (-) True LOC110522983
trnaa-agc-3 mRNA downstream 350101 61266697 ~ 61266769 (-) True trnaa-agc-3
XM_021603710.2 mRNA downstream 374864 61139319 ~ 61242006 (-) False LOC110524243
XM_021603711.2 mRNA downstream 374864 61139319 ~ 61242006 (-) True LOC110524243
XM_021603713.2 mRNA downstream 400269 61139319 ~ 61216601 (-) False LOC110524243
XM_021603720.2 mRNA upstream 743 61617987 ~ 61622355 (-) False LOC110524247
XM_021603723.2 mRNA upstream 42905 61660149 ~ 61679106 (-) True LOC110524249
XM_021603730.2 mRNA upstream 145874 61763118 ~ 61786354 (-) False LOC110524252
XM_021603729.2 mRNA upstream 145874 61763118 ~ 61786542 (-) True LOC110524252
XM_021601328.2 mRNA upstream 224317 61841561 ~ 61842727 (-) True tssk6
TU479791 other downstream 545727 61058994 ~ 61071143 (-) True LOC110524239
TU478587 other downstream 1515814 60100765 ~ 60101056 (-) True G422347
TU477230 other downstream 2478613 59132870 ~ 59138257 (-) True lsg1
TU477090 other downstream 2580571 59026103 ~ 59036299 (-) True G420982
TU476443 other downstream 3202727 58413128 ~ 58414143 (-) True G420421
TU480919 other upstream 32723 61649967 ~ 61651775 (-) True G424499
TU480929 other upstream 41789 61659033 ~ 61659585 (-) True G424502
TU481096 other upstream 270954 61888198 ~ 61927422 (-) False G424649
TU481097 other upstream 270954 61888198 ~ 61913769 (-) True G424649
TU481131 other upstream 381282 61998526 ~ 62001309 (-) True G424678

Expression Profile


TU480894 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU480894 Expression in each Bioproject

Bar chart with 18 bars.
TU480894 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.