RNA id: TU510180



Basic Information


Item Value
RNA id TU510180
length 317
RNA type TUCP
GC content 0.49
exon number 1
gene id G450752
representative True

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 85486842 ~ 85487158 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aattgatcgcccccatctagcttcagagttcgttctgttaggtgacctaaactgggatatgcttaacaccccggcagtcctacaatctaagctagatgccctcaatctcacacaaatcatcaaggaacccaccaggtacaaccctaaatccgtaaacatgggcaccatcatagacattatcctgatcaacttgccctccaaatacacctccgctgttttcaatccggatctcagcgatcactgcctcattgcctgtatccgctatgggtccgtggtcaaacaaccacccctcatcactgtcaaacgctccctaaacc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU510128 lncRNA downstream 40057 85445878 ~ 85446785 (-) False lurap1
TU510129 lncRNA downstream 40057 85445878 ~ 85446785 (-) False lurap1
TU510130 lncRNA downstream 40057 85445878 ~ 85446785 (-) False lurap1
TU510132 lncRNA downstream 40057 85445878 ~ 85446785 (-) False lurap1
TU510134 lncRNA downstream 40057 85445878 ~ 85446785 (-) False lurap1
TU510198 lncRNA upstream 38653 85525811 ~ 85527502 (-) True G450767
TU510228 lncRNA upstream 95608 85582766 ~ 85612910 (-) True G450790
TU510239 lncRNA upstream 128822 85615980 ~ 85619096 (-) True G450801
TU510256 lncRNA upstream 155678 85642836 ~ 85643526 (-) True G450818
TU510263 lncRNA upstream 168376 85655534 ~ 85655803 (-) True G450825
XM_036978603.1 mRNA downstream 14420 85443496 ~ 85472422 (-) False lurap1
XM_036979076.1 mRNA downstream 43606 85435129 ~ 85443236 (-) True LOC118964733
XM_036978599.1 mRNA downstream 311405 84934006 ~ 85175437 (-) True LOC110524715
XM_036978600.1 mRNA downstream 384920 85100248 ~ 85101922 (-) True LOC118964676
XM_021604591.2 mRNA downstream 553720 84880003 ~ 84933122 (-) True znhit6
XM_021604598.2 mRNA upstream 15809 85502967 ~ 85511477 (-) True LOC110524719
XM_036978612.1 mRNA upstream 44532 85531690 ~ 85652797 (-) True sgip1a
XM_021604606.2 mRNA upstream 195151 85682309 ~ 85695967 (-) False pde4ba
XM_036978616.1 mRNA upstream 195151 85682309 ~ 85709070 (-) False pde4ba
XM_036978614.1 mRNA upstream 195151 85682309 ~ 85790364 (-) False pde4ba
TU510133 other downstream 14962 85445681 ~ 85471880 (-) False lurap1
TU510077 other downstream 143770 85342788 ~ 85343072 (-) True G450676
TU507563 other downstream 1570201 83916136 ~ 83916641 (-) True G448452
TU507522 other downstream 1613534 83871602 ~ 83873308 (-) True G448411
TU507137 other downstream 1966569 83510353 ~ 83520273 (-) True G448079
TU510403 other upstream 390575 85877733 ~ 85878974 (-) True G450957
TU510750 other upstream 1061680 86548838 ~ 86549878 (-) True G451271
TU510765 other upstream 1110194 86597352 ~ 86597744 (-) True G451286
TU511053 other upstream 1278425 86765583 ~ 86765987 (-) True ror1
TU511399 other upstream 1754696 87241854 ~ 87243233 (-) True G451856

Expression Profile


TU510180 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU510180 Expression in each Bioproject

Bar chart with 20 bars.
TU510180 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.