RNA id: TU512205



Basic Information


Item Value
RNA id TU512205
length 674
RNA type TUCP
GC content 0.50
exon number 1
gene id G452504
representative True

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 87983960 ~ 87984633 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tagtcacggttttgtctcaccaggagtgatggtcggattcacgtttatcgtcgaaggaatgagcgttacaccgaggcctgtactctggagtgggatcgatttggaggtggagggtccgtcacggtctggggctgtgtgtcacagcagcatcggactgagcttgttgtcattgtaggcaatctcaacgctgtgcgttacagggaagacatcctcctccctcatgtggtacccttcctgcaggctcatcctgacatgaccctccaggatgacaatgccaccagccatactactcgttctgtgcgtgatttcctgcaagacaggaatgttagtgttctgccatggccagcgaagagcccagatctcaatcccattgaacacgtctgggacctgttggatcggagggtgagggctagggccattccccccagaaatgtccgggaacttgcaggtgccttggtggaagagtggggtaacatctcacagcaagaacaggcaaatctggtgcagttcatgaggaggagatgcactgcagtacttaatgcagctggtggccacaccagatactgactgttacttttgattttgacacattatttaatttctgttagtcacctgtctgtggaacttgttcagtttatatctcagttgttgaatcttgttatgtccatacaaat

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU512204 lncRNA downstream 130 87983583 ~ 87983830 (-) True G452503
TU512203 lncRNA downstream 660 87982968 ~ 87983300 (-) True G452502
TU512198 lncRNA downstream 10198 87973228 ~ 87973762 (-) True G452497
TU512194 lncRNA downstream 14173 87969560 ~ 87969787 (-) True G452493
TU512193 lncRNA downstream 15486 87968246 ~ 87968474 (-) True G452492
TU512212 lncRNA upstream 11939 87996572 ~ 87996791 (-) True G452511
TU512223 lncRNA upstream 29135 88013768 ~ 88014021 (-) True G452522
TU512224 lncRNA upstream 30333 88014966 ~ 88015190 (-) True G452523
TU512225 lncRNA upstream 30866 88015499 ~ 88015841 (-) True G452524
TU512226 lncRNA upstream 31456 88016089 ~ 88016374 (-) True G452525
XR_005051885.1 mRNA downstream 324440 87657929 ~ 87659520 (-) True LOC110522895
XM_021603308.2 mRNA downstream 463910 87505749 ~ 87520050 (-) True usp1
XM_021603307.2 mRNA downstream 463911 87505749 ~ 87520049 (-) False usp1
XM_021604639.2 mRNA downstream 559892 87419230 ~ 87424068 (-) True angptl3
XM_021604628.2 mRNA downstream 582547 87391661 ~ 87401413 (-) True atg4c
XM_021604649.2 mRNA upstream 277942 88262575 ~ 88268140 (-) False LOC110524751
XR_002473645.2 mRNA upstream 277942 88262575 ~ 88268140 (-) True LOC110524751
XM_036978661.1 mRNA upstream 321295 88305928 ~ 88345287 (-) False ap1m3
XM_036978660.1 mRNA upstream 321295 88305928 ~ 88348088 (-) True ap1m3
XM_036978662.1 mRNA upstream 363700 88348333 ~ 88355068 (-) True c5h1orf210
TU512158 other downstream 88748 87894732 ~ 87895212 (-) True G452457
TU512143 other downstream 117496 87860127 ~ 87866464 (-) True G452442
TU512060 other downstream 178095 87774222 ~ 87805865 (-) True LOC110523029
TU511933 other downstream 484824 87498366 ~ 87499136 (-) True G452255
TU511399 other downstream 740727 87241854 ~ 87243233 (-) True G451856
TU512218 other upstream 21286 88005919 ~ 88006587 (-) True G452517
TU512280 other upstream 89961 88074594 ~ 88075005 (-) True G452575
TU512830 other upstream 610818 88595451 ~ 88596395 (-) True G452999
TU513651 other upstream 1167107 89151740 ~ 89154263 (-) False mast2
TU513653 other upstream 1167107 89151740 ~ 89154263 (-) False mast2

Expression Profile


TU512205 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU512205 Expression in each Bioproject

Bar chart with 21 bars.
TU512205 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.