RNA id: TU517291



Basic Information


Item Value
RNA id TU517291
length 266
lncRNA type inter_gene
GC content 0.46
exon number 2
gene id G456764
representative True

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 92962751 ~ 92967673 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttacggtgagtgaatgaggacccaaaagcgaactaacttaaacagagcttctttaataaccaaacataggtaggctcagatagaccggcagattccgacaggacaggacaaggttacagcaaacatgacgacagtctggttcaggcatgaaacacaacaaacaagaatccgacaaggacaggaacaaaaacagagagagatataggggactaatcagagggaaaaggggaacaggtgggagaaggggtgacgaggtagtcaagag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU517263 lncRNA upstream 5034 92942417 ~ 92957717 (+) True si:ch211-284e20.8
TU517245 lncRNA upstream 28934 92931926 ~ 92933817 (+) True G456729
TU517243 lncRNA upstream 29009 92931926 ~ 92933742 (+) False G456729
TU517224 lncRNA upstream 57041 92890594 ~ 92905710 (+) False G456714
TU517253 lncRNA downstream 34330 93002003 ~ 93017422 (+) False G456731
TU517269 lncRNA downstream 56618 93024291 ~ 93029202 (+) True G456742
TU517271 lncRNA downstream 81681 93049354 ~ 93051144 (+) True G456744
TU517310 lncRNA downstream 94808 93062481 ~ 93062746 (+) True G456783
TU517315 lncRNA downstream 104987 93072660 ~ 93072878 (+) True G456788
XM_036978835.1 mRNA upstream 8553 92942035 ~ 92954198 (+) False si:ch211-284e20.8
XM_021604736.2 mRNA upstream 31133 92927124 ~ 92931618 (+) True fetub
XM_036978834.1 mRNA upstream 55572 92881372 ~ 92907179 (+) True ahsg1
XM_036978833.1 mRNA upstream 87175 92869491 ~ 92875576 (+) False si:ch211-262h13.5
XR_005051898.1 mRNA upstream 87175 92869491 ~ 92875576 (+) True si:ch211-262h13.5
XM_036978802.1 mRNA downstream 828 92968501 ~ 92994645 (+) False hps3
XM_036978805.1 mRNA downstream 829 92968502 ~ 92994435 (+) False hps3
XM_036978803.1 mRNA downstream 830 92968503 ~ 92994087 (+) False hps3
XM_036978796.1 mRNA downstream 832 92968505 ~ 93001381 (+) False hps3
XM_036978797.1 mRNA downstream 833 92968506 ~ 93001381 (+) False hps3
TU516493 other upstream 961993 91944120 ~ 92000758 (+) False G456139
TU517251 other downstream 34330 93002003 ~ 93017422 (+) False G456731
TU517255 other downstream 34330 93002003 ~ 93041462 (+) False G456731
TU517257 other downstream 34330 93002003 ~ 93041462 (+) False G456731
TU517252 other downstream 62843 93030516 ~ 93041462 (+) True G456731
TU517396 other downstream 254233 93221906 ~ 93225091 (+) True LOC110524836

Expression Profile


TU517291 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU517291 Expression in each Bioproject

Bar chart with 16 bars.
TU517291 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.