RNA id: TU554093



Basic Information


Item Value
RNA id TU554093
length 218
lncRNA type inter_gene
GC content 0.53
exon number 1
gene id G487529
representative True

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 23673929 ~ 23674146 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gcttagccctaggcgaatggcgacagtggttggagggggcgaccgttccttttgtcgtttggactgaccataggaaccttgagtacatccgttctgccaaacgacttaatgcgcgtcaggcgcgctgggcgctgtttttcgctcgtttcgagttcgtgatttcttatcgtccgggctctaagaacaccaagcctgatgctttatctcatctcttcagt

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU554045 lncRNA downstream 78946 23594705 ~ 23594983 (-) True G487504
TU554044 lncRNA downstream 79775 23593953 ~ 23594154 (-) True G487503
TU554042 lncRNA downstream 82872 23590664 ~ 23591057 (-) True G487501
TU554037 lncRNA downstream 88375 23582929 ~ 23585554 (-) False LOC110525180
TU554028 lncRNA downstream 99294 23574387 ~ 23574635 (-) True G487495
TU554106 lncRNA upstream 23072 23697218 ~ 23699515 (-) True G487538
TU554119 lncRNA upstream 29388 23703534 ~ 23704259 (-) True G487546
TU554118 lncRNA upstream 33872 23708018 ~ 23710130 (-) True LOC110525551
TU554113 lncRNA upstream 44240 23718386 ~ 23720835 (-) True LOC110525553
TU554126 lncRNA upstream 55162 23729308 ~ 23729536 (-) True G487553
XM_021605745.2 mRNA downstream 5561 23644995 ~ 23668368 (-) False LOC110525548
XM_021605746.2 mRNA downstream 5561 23644995 ~ 23668368 (-) False LOC110525548
XM_021605748.2 mRNA downstream 5561 23644995 ~ 23668368 (-) False LOC110525548
XM_021605749.2 mRNA downstream 5561 23644995 ~ 23668368 (-) False LOC110525548
XM_021605750.2 mRNA downstream 5561 23644995 ~ 23668368 (-) False LOC110525548
XM_036979678.1 mRNA upstream 32411 23706557 ~ 23710173 (-) False LOC110525551
XR_002473770.2 mRNA upstream 32411 23706557 ~ 23710179 (-) False LOC110525551
XR_002473774.2 mRNA upstream 32411 23706557 ~ 23710195 (-) False LOC110525551
XR_002473773.2 mRNA upstream 32411 23706557 ~ 23710205 (-) False LOC110525551
XR_002473771.2 mRNA upstream 32411 23706557 ~ 23710214 (-) False LOC110525551
TU554033 other downstream 88375 23583036 ~ 23585554 (-) False LOC110525180
TU554039 other downstream 88375 23583036 ~ 23585554 (-) True LOC110525180
TU553494 other downstream 281867 23390017 ~ 23392062 (-) True G487016
TU553500 other downstream 288022 23385534 ~ 23385907 (-) True G487022
TU553428 other downstream 420568 23251286 ~ 23253361 (-) False G486953
TU554111 other upstream 39729 23713875 ~ 23717783 (-) True LOC110525552
TU555138 other upstream 679387 24353533 ~ 24353823 (-) True G488386
TU555289 other upstream 986751 24660897 ~ 24674901 (-) False LOC110525585
TU555288 other upstream 1032425 24706571 ~ 24709420 (-) False LOC110525585
TU555826 other upstream 1432059 25106205 ~ 25106570 (-) True G489038

Expression Profile


TU554093 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU554093 Expression in each Bioproject

Bar chart with 7 bars.
TU554093 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.