RNA id: TCONS_00032747


Basic Information

Item Value
RNA id TCONS_00032747
length 190
RNA type mRNA
GC content 0.42
exon number 3
gene id XLOC_016683
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 38231695 ~ 38261272 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTTACTGTGAAGTTTCTTTCACACAGTAATGGGGAGGAAAGAGAAACTCCTGATTTGTTCTTTCTTTGTGTCAGTTTACATGCTGACACTTGGGAAATGTGGTCCTGTAAATGCAGCTGCAGACTGGAGCAATGGACAAGATCCAGCATTTATGGCAATGGATTCCACAAAAGAAAAAAGAGCCACAGAG

Function

GO:

id name namespace
GO:0016567 protein ubiquitination biological_process
GO:0005737 cytoplasm cellular_component
GO:0061630 ubiquitin protein ligase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030616-581 Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in protein ubiquitination. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDART00000173064

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00032745 lncRNA downstream 28722 38216345 ~ 38225373 (-) True XLOC_016682
TCONS_00033892 lncRNA downstream 59616 38192959 ~ 38194479 (-) True XLOC_016681
TCONS_00033891 lncRNA downstream 108394 38144162 ~ 38145701 (-) True XLOC_016680
TCONS_00032737 lncRNA downstream 112118 38138350 ~ 38141977 (-) True XLOC_016679
TCONS_00033384 lncRNA downstream 438722 37813663 ~ 37815373 (-) True XLOC_016662
TCONS_00032760 lncRNA upstream 741459 38998048 ~ 38998761 (-) False XLOC_016690
TCONS_00032761 lncRNA upstream 756331 39012920 ~ 39015104 (-) True XLOC_016690
TCONS_00032767 lncRNA upstream 825707 39082296 ~ 39086574 (-) False XLOC_016693
TCONS_00033386 lncRNA upstream 1353732 39610321 ~ 39612464 (-) True XLOC_016697
TCONS_00032775 lncRNA upstream 1477980 39734569 ~ 39737898 (-) False XLOC_016698
TCONS_00032740 mRNA downstream 28623 38197853 ~ 38225472 (-) False XLOC_016682
TCONS_00032744 mRNA downstream 28707 38204733 ~ 38225388 (-) False XLOC_016682
TCONS_00032738 mRNA downstream 47764 38197820 ~ 38206331 (-) False XLOC_016682
TCONS_00032742 mRNA downstream 47954 38201838 ~ 38206141 (-) False XLOC_016682
TCONS_00032739 mRNA downstream 48061 38197830 ~ 38206034 (-) False XLOC_016682
TCONS_00032748 mRNA upstream 20686 38277275 ~ 38282079 (-) True XLOC_016684
TCONS_00032749 mRNA upstream 26058 38282647 ~ 38284648 (-) False XLOC_016685
TCONS_00032750 mRNA upstream 26058 38282647 ~ 38284749 (-) True XLOC_016685
TCONS_00032751 mRNA upstream 28825 38285414 ~ 38288024 (-) False XLOC_016686
TCONS_00032752 mRNA upstream 29423 38286012 ~ 38287987 (-) False XLOC_016686
TCONS_00032743 other downstream 49302 38203941 ~ 38204793 (-) False XLOC_016682
TCONS_00032691 other downstream 844938 37405351 ~ 37409157 (-) True XLOC_016651
TCONS_00032658 other downstream 1580176 36670656 ~ 36673919 (-) False XLOC_016631
TCONS_00032657 other downstream 1582937 36664770 ~ 36671158 (-) False XLOC_016631
TCONS_00032643 other downstream 1921764 36332018 ~ 36332331 (-) True XLOC_016617
TCONS_00032764 other upstream 806165 39062754 ~ 39068546 (-) False XLOC_016693
TCONS_00032769 other upstream 1114222 39370811 ~ 39370927 (-) True XLOC_016694
TCONS_00032776 other upstream 1478963 39735552 ~ 39752556 (-) True XLOC_016698
TCONS_00032777 other upstream 1670372 39926961 ~ 40026622 (-) False XLOC_016700
TCONS_00032778 other upstream 1752149 40008738 ~ 40026622 (-) True XLOC_016700