RNA id: TU626863



Basic Information


Item Value
RNA id TU626863
length 201
lncRNA type inter_gene
GC content 0.40
exon number 2
gene id G553404
representative True

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 83708717 ~ 83709973 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aggtttaacagtcctttagggttagggttaacagtcctttagggttaggtttaacagtcctttagggttaggtttaacagtcctttagggttaggtttaacagtcctttagggttaggtttaacagtcctttagggttagggttaacagtccattagggttaggtttaacagtcctttagggttaacagtcctttagggtt

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU626847 lncRNA downstream 45823 83662679 ~ 83662894 (-) True G553388
TU626846 lncRNA downstream 46107 83661387 ~ 83662610 (-) True G553387
TU626842 lncRNA downstream 61843 83643336 ~ 83646874 (-) True G553384
TU626830 lncRNA downstream 74544 83633632 ~ 83634173 (-) True G553375
TU626828 lncRNA downstream 76836 83631669 ~ 83631881 (-) True G553373
TU626866 lncRNA upstream 2946 83712919 ~ 83713263 (-) True G553407
TU626870 lncRNA upstream 8484 83718457 ~ 83719408 (-) True G553411
TU626871 lncRNA upstream 9542 83719515 ~ 83719730 (-) True G553412
TU626872 lncRNA upstream 10810 83720783 ~ 83720994 (-) True G553413
TU626873 lncRNA upstream 12306 83722279 ~ 83722491 (-) True G553414
XM_036981207.1 mRNA downstream 3753 83647271 ~ 83704964 (-) False LOC100136088
XM_036981208.1 mRNA downstream 3753 83647271 ~ 83704964 (-) False LOC100136088
XM_036981210.1 mRNA downstream 3753 83647271 ~ 83704964 (-) True LOC100136088
XM_036981211.1 mRNA downstream 3754 83647271 ~ 83704963 (-) False LOC100136088
XM_036981209.1 mRNA downstream 3756 83647271 ~ 83704961 (-) False LOC100136088
XM_036981230.1 mRNA upstream 26863 83736836 ~ 83738715 (-) True LOC110526710
XM_036981215.1 mRNA upstream 46250 83756223 ~ 83911998 (-) False LOC118964944
XM_036981212.1 mRNA upstream 46250 83756223 ~ 83912000 (-) False LOC118964944
XM_036981214.1 mRNA upstream 46250 83756223 ~ 83912000 (-) True LOC118964944
LOC110526992 mRNA upstream 156435 83866408 ~ 83868699 (-) True LOC110526992
TU626345 other downstream 335521 83345201 ~ 83373196 (-) True G552980
TU625906 other downstream 1042272 82665477 ~ 82666445 (-) True G552584
TU625865 other downstream 1088473 82613557 ~ 82620244 (-) False G552558
TU625893 other downstream 1091523 82609918 ~ 82617194 (-) True G552571
TU626966 other upstream 166241 83876214 ~ 83879504 (-) False G553491
TU626967 other upstream 167804 83877777 ~ 83879504 (-) False G553491
TU626965 other upstream 168735 83878708 ~ 83879504 (-) True G553491
TU626958 other upstream 224888 83934861 ~ 83954230 (-) True LOC110526720
TU627232 other upstream 388039 84098012 ~ 84175022 (-) True G553707

Expression Profile


TU626863 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU626863 Expression in each Bioproject

Bar chart with 5 bars.
TU626863 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.