RNA id: TU639407



Basic Information


Item Value
RNA id TU639407
length 204
lncRNA type inter_gene
GC content 0.34
exon number 1
gene id G562746
representative True

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 96501889 ~ 96502092 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TGTGGGAAGATATAAGGGAGTCTGACTATTGGGAAATGAATGTTGAAGAAAAGTACACTGAATTTAGACTACCAAACGGCTATTTAGGCCCAATCACCACCTATTCAGAGTAAGTTACTATAGATAGTTCAGTTTGAAACATTCTCTATGAAATGGGCTTTTACATTATGTGTAATTAATTGTATGTAGTTACCTATTGGTGTA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU639403 lncRNA upstream 7936 96492628 ~ 96493953 (+) True G562742
TU639388 lncRNA upstream 31050 96467391 ~ 96470839 (+) True G562732
TU639353 lncRNA upstream 84418 96414380 ~ 96417471 (+) True G562706
TU639376 lncRNA upstream 89893 96411789 ~ 96411996 (+) True G562721
TU639375 lncRNA upstream 96349 96405205 ~ 96405540 (+) True G562720
TU639409 lncRNA downstream 5397 96507489 ~ 96509735 (+) False G562748
TU639411 lncRNA downstream 5862 96507954 ~ 96509528 (+) False G562748
TU639410 lncRNA downstream 7305 96509397 ~ 96509735 (+) True G562748
TU639415 lncRNA downstream 24350 96526442 ~ 96527300 (+) True G562751
TU639427 lncRNA downstream 39538 96541630 ~ 96607890 (+) True G562755
XM_036981671.1 mRNA upstream 109991 96323229 ~ 96391898 (+) False LOC110514610
XM_036981668.1 mRNA upstream 488989 95996933 ~ 96012900 (+) False LOC118965000
XM_036981666.1 mRNA upstream 531392 95900120 ~ 95970497 (+) False LOC110510618
XM_036981667.1 mRNA upstream 534413 95900120 ~ 95967476 (+) False LOC110510618
XM_036981810.1 mRNA upstream 601806 95899021 ~ 95900083 (+) True LOC118965061
XM_036981677.1 mRNA downstream 494921 96997013 ~ 97014268 (+) True LOC110507008
XR_005052365.1 mRNA downstream 848413 97350505 ~ 97352860 (+) False LOC118965002
XR_005052366.1 mRNA downstream 849994 97352086 ~ 97352860 (+) False LOC118965002
XM_036981678.1 mRNA downstream 867619 97369711 ~ 97529904 (+) False LOC110516620
XM_036981685.1 mRNA downstream 1034442 97536534 ~ 97670291 (+) True LOC110513174
TU639398 other upstream 14664 96481834 ~ 96487225 (+) True G562740
TU639369 other upstream 113949 96384736 ~ 96387940 (+) False G562719
TU639366 other upstream 113949 96385976 ~ 96387940 (+) False G562719
TU638900 other upstream 489641 95996318 ~ 96012248 (+) True LOC118965000
TU638849 other upstream 531381 95968333 ~ 95970508 (+) True LOC110510618
TU640468 other downstream 1006197 97508289 ~ 97512840 (+) True LOC110516620
TU640637 other downstream 1240060 97742152 ~ 97795626 (+) True LOC118936669
TU640763 other downstream 1420539 97922631 ~ 97923034 (+) True G563588
TU640776 other downstream 1447981 97950073 ~ 97951916 (+) False G563596
TU641659 other downstream 1978488 98480580 ~ 98483302 (+) True G564164

Expression Profile


TU639407 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU639407 Expression in each Bioproject

Bar chart with 1 bar.
TU639407 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.