RNA id: TU640588



Basic Information


Item Value
RNA id TU640588
length 278
lncRNA type intronic
GC content 0.40
exon number 2
gene id G563474
representative True

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 97598173 ~ 97599064 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtgttgacagtagtgtgttgatagtagtgatggaacaagagaacagactgataactgatgtactgtagctgatgtgatagtgttgatagtagtgatggaacaagagaacagactgataactgatatactgtagccgatgtgatagtgttgacagtagtgatggaacaagagaacagactgataactgatatactgtagctgatgtgatagtgttgacagtagtgatggaacaagagaacagactgatgtactgtagctgatgtgatagtgttgacagt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU640576 lncRNA upstream 14506 97582997 ~ 97583667 (+) True G563467
TU640464 lncRNA upstream 63804 97532839 ~ 97534369 (+) True G563404
TU640562 lncRNA upstream 88235 97508666 ~ 97509938 (+) True G563456
TU640554 lncRNA upstream 107005 97489970 ~ 97491168 (+) True G563448
TU640549 lncRNA upstream 114340 97482716 ~ 97483833 (+) False G563445
TU640476 lncRNA downstream 8571 97607635 ~ 97673051 (+) True G563412
TU640597 lncRNA downstream 11098 97610162 ~ 97611905 (+) True G563477
TU640604 lncRNA downstream 24121 97623185 ~ 97623624 (+) True G563483
TU640629 lncRNA downstream 82507 97681571 ~ 97682086 (+) True G563495
TU640655 lncRNA downstream 124325 97723389 ~ 97725161 (+) True G563516
XM_036981678.1 mRNA upstream 68269 97369711 ~ 97529904 (+) False LOC110516620
XR_005052365.1 mRNA upstream 245313 97350505 ~ 97352860 (+) False LOC118965002
XR_005052366.1 mRNA upstream 245313 97352086 ~ 97352860 (+) False LOC118965002
XM_036981677.1 mRNA upstream 583905 96997013 ~ 97014268 (+) True LOC110507008
XM_036981671.1 mRNA upstream 1206275 96323229 ~ 96391898 (+) False LOC110514610
XM_036981815.1 mRNA downstream 80853 97679917 ~ 97796621 (+) False LOC118936669
XM_036981686.1 mRNA downstream 198595 97797659 ~ 97943775 (+) True plekhg4
XR_005052367.1 mRNA downstream 345192 97944256 ~ 97947528 (+) False LOC118965004
XR_005052368.1 mRNA downstream 345192 97944256 ~ 97947528 (+) False LOC118965004
XR_005052369.1 mRNA downstream 345192 97944256 ~ 97947528 (+) True LOC118965004
TU640468 other upstream 85333 97508289 ~ 97512840 (+) True LOC110516620
TU639398 other upstream 1110948 96481834 ~ 96487225 (+) True G562740
TU639369 other upstream 1210233 96384736 ~ 96387940 (+) False G562719
TU639366 other upstream 1210233 96385976 ~ 96387940 (+) False G562719
TU638900 other upstream 1585925 95996318 ~ 96012248 (+) True LOC118965000
TU640637 other downstream 143088 97742152 ~ 97795626 (+) True LOC118936669
TU640763 other downstream 323567 97922631 ~ 97923034 (+) True G563588
TU640776 other downstream 351009 97950073 ~ 97951916 (+) False G563596
TU641659 other downstream 881516 98480580 ~ 98483302 (+) True G564164
TU642010 other downstream 1201446 98800510 ~ 98824338 (+) False LOC110526849

Expression Profile


TU640588 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU640588 Expression in each Bioproject

Bar chart with 13 bars.
TU640588 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.