RNA id: TU717694



Basic Information


Item Value
RNA id TU717694
length 349
lncRNA type inter_gene
GC content 0.36
exon number 1
gene id G631253
representative True

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 60855431 ~ 60855779 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tgaagatacagtgccttgtgaaagtattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttatgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacgtttttaacaaatcaaaaactgaaaaattggccgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctctgtataaatg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU717679 lncRNA downstream 8229 60847000 ~ 60847202 (-) True G631238
TU717655 lncRNA downstream 25783 60829386 ~ 60829648 (-) True G631214
TU717563 lncRNA downstream 99987 60753024 ~ 60755444 (-) True LOC110528989
TU717567 lncRNA downstream 152817 60699480 ~ 60702614 (-) False LOC110528989
TU717315 lncRNA downstream 279955 60488050 ~ 60575476 (-) True G630902
TU717763 lncRNA upstream 30020 60885799 ~ 60888175 (-) True G631321
TU717867 lncRNA upstream 89342 60945121 ~ 60945582 (-) True G631414
TU717871 lncRNA upstream 94950 60950729 ~ 60951670 (-) True G631417
TU717916 lncRNA upstream 193210 61048989 ~ 61049236 (-) True G631462
TU718182 lncRNA upstream 279660 61135439 ~ 61135704 (-) True G631709
XM_036983697.1 mRNA downstream 32906 60699279 ~ 60822525 (-) False LOC110528989
XM_036983695.1 mRNA downstream 32907 60699279 ~ 60822524 (-) False LOC110528989
XM_021609979.2 mRNA upstream 74522 60930301 ~ 60933747 (-) True LOC110528153
XM_021609980.2 mRNA upstream 90285 60946064 ~ 61041619 (-) False LOC110528154
XM_036983701.1 mRNA upstream 90849 60946628 ~ 60969307 (-) False LOC110528154
XM_021609981.2 mRNA upstream 90849 60946628 ~ 61041551 (-) False LOC110528154
XM_036983700.1 mRNA upstream 90849 60946628 ~ 61041574 (-) True LOC110528154
TU717562 other downstream 107332 60738495 ~ 60748099 (-) False LOC110528989
TU717152 other downstream 771574 60083046 ~ 60083857 (-) True G630747
TU716577 other downstream 937880 59915979 ~ 59917551 (-) False G630227
TU718213 other upstream 334929 61190708 ~ 61191045 (-) True G631740
TU718160 other upstream 342228 61198007 ~ 61199438 (-) True G631687
TU718974 other upstream 835469 61691248 ~ 61691644 (-) True G632459
TU719566 other upstream 1365493 62221272 ~ 62221678 (-) False G632994
TU719571 other upstream 1365493 62221272 ~ 62222050 (-) False G632994

Expression Profile


TU717694 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU717694 Expression in each Bioproject

Bar chart with 18 bars.
TU717694 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.