RNA id: TU750613



Basic Information


Item Value
RNA id TU750613
length 239
lncRNA type intronic
GC content 0.52
exon number 2
gene id G659942
representative True

Chromosome Information


Item Value
chromosome id NC_048571.1
NCBI id CM023225.2
chromosome length 90918291
location 87168512 ~ 87168790 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTGACTTAGAGAAGCAAGTGTCTGAGACGCCAAGCGTGACTCAGAGAAGCAAGTGTCTTTGATACGCCCAGCGTGACTCAGAGAAGCAAGTGTCTGAGACGCCCAGCGTGACTTAGAGAAGCAAGTGTCTCTGAGACGCCCAGCGTGACTTAAAGAAGCAAGACTCTTTGAGACGTCCAGCGTGACTTAGAGGAGGAGCAAGTGTCTCTGAGACGCCCAGTGTGACTTAGAGAAGCAAG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU750607 lncRNA downstream 9268 87158397 ~ 87159244 (-) True G659936
TU750600 lncRNA downstream 21382 87146689 ~ 87147130 (-) True G659930
TU750595 lncRNA downstream 39697 87128295 ~ 87128815 (-) True G659925
TU750575 lncRNA downstream 66338 87100464 ~ 87102174 (-) True G659907
TU750574 lncRNA downstream 66389 87097875 ~ 87102123 (-) False G659907
TU750615 lncRNA upstream 1339 87170129 ~ 87170767 (-) True G659944
TU750624 lncRNA upstream 8664 87177454 ~ 87177795 (-) True G659953
TU750631 lncRNA upstream 14981 87183771 ~ 87184132 (-) True G659959
TU750645 lncRNA upstream 27555 87196345 ~ 87198456 (-) False G659969
TU750647 lncRNA upstream 27555 87196345 ~ 87198456 (-) False G659969
XR_005052725.1 mRNA downstream 108648 87058268 ~ 87059864 (-) True LOC118965396
XM_036984286.1 mRNA downstream 114638 87007438 ~ 87053874 (-) True atrip
XM_036984283.1 mRNA downstream 201520 86944797 ~ 86966992 (-) False LOC110528663
XM_036984284.1 mRNA downstream 201520 86944797 ~ 86966992 (-) True LOC110528663
XM_036984282.1 mRNA downstream 347999 86723768 ~ 86820513 (-) False poc1a
XM_021610803.2 mRNA upstream 172399 87341189 ~ 87342665 (-) True wu:fb55g09
XM_021610805.2 mRNA upstream 241390 87410180 ~ 87422713 (-) False si:dkeyp-87e7.4
XM_036984297.1 mRNA upstream 308599 87477389 ~ 87494213 (-) True LOC110528674
XM_036984300.1 mRNA upstream 326596 87495386 ~ 87554716 (-) False pxk
XM_036984298.1 mRNA upstream 326596 87495386 ~ 87554717 (-) False pxk
TU750481 other downstream 161220 87003736 ~ 87007292 (-) True G659824
TU750071 other downstream 534656 86632407 ~ 86633856 (-) True G659543
TU749640 other downstream 1007589 86160242 ~ 86160923 (-) True G659250
TU748304 other downstream 2161007 85006726 ~ 85007505 (-) False G658255
TU750588 other upstream 116111 87284901 ~ 87293755 (-) True LOC110528667
TU752038 other upstream 1084273 88253063 ~ 88259405 (-) True LOC110528687
TU752275 other upstream 1590703 88759493 ~ 88759938 (-) True G661128
TU752665 other upstream 1884286 89053076 ~ 89061481 (-) True G661426
TU752543 other upstream 1928257 89097047 ~ 89098578 (-) False G661335

Expression Profile


TU750613 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU750613 Expression in each Bioproject

Bar chart with 13 bars.
TU750613 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.