RNA id: LOC118965625



Basic Information


Item Value
RNA id LOC118965625
length 329
RNA type mRNA
GC content 0.51
exon number 4
gene id LOC118965625
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49983389 ~ 49986205 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ATGAAGCCATCATTTGCCCTCGTCTTGCCTCTCCTCCTCATACCCTTCATCAGTGCCCAGGTACCCCACTGGGGGCCTTGTCCAGAACCAGCCGTCCAGCCTGCCTTCAGCATGAAAAAGTTCATGGGAAGATGGTTTGAAATCAGCAAACTGCCAGCCCAGTTTGAGAAGGGGAGATGCATCGAGACCAACTTCTCCATGAAGGGCTGATCAGACTATTCGAGTGGTCAGCTCTGAAATATTAAAGGAAGAGCTAAGGATTATTGAGGGGAGTCACCGAGGACTTGAAGAACCCAGCCAAGTTGGGCATCAGCTACTCTTACGCCTGA

Function


GO:

id name namespace
GO:0006810 transport biological_process
GO:0005576 extracellular region cellular_component
GO:0005215 transporter activity molecular_function
GO:0008289 lipid binding molecular_function

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU816479 lncRNA downstream 35266 49947768 ~ 49948123 (-) True G718598
TU816475 lncRNA downstream 39161 49943716 ~ 49944228 (-) True G718594
TU816471 lncRNA downstream 48353 49934833 ~ 49935036 (-) True G718590
TU816462 lncRNA downstream 58509 49924642 ~ 49924880 (-) True G718581
TU816461 lncRNA downstream 59061 49924061 ~ 49924328 (-) True G718580
TU816514 lncRNA upstream 8721 49994926 ~ 50001193 (-) True G718625
TU816554 lncRNA upstream 65240 50051445 ~ 50059575 (-) True G718663
TU816538 lncRNA upstream 82308 50068513 ~ 50071983 (-) False G718648
TU816539 lncRNA upstream 82308 50068513 ~ 50071983 (-) True G718648
TU816673 lncRNA upstream 254796 50241001 ~ 50241249 (-) True G718780
XM_021612768.2 mRNA downstream 13307 49964914 ~ 49970082 (-) True LOC110530012
XM_036985558.1 mRNA downstream 46388 49866274 ~ 49937001 (-) False LOC110530011
XM_021612767.2 mRNA downstream 61889 49866273 ~ 49921500 (-) False LOC110530011
XM_021612765.2 mRNA downstream 74229 49866272 ~ 49909160 (-) False LOC110530011
XM_021612766.2 mRNA downstream 74229 49866272 ~ 49909160 (-) False LOC110530011
XM_021612771.2 mRNA upstream 107292 50093497 ~ 50095929 (-) True LOC110530015
XM_021612772.2 mRNA upstream 351526 50337731 ~ 50366270 (-) True LOC110530016
XM_021612779.2 mRNA upstream 426775 50412980 ~ 50434787 (-) False LOC110530021
XM_036985563.1 mRNA upstream 426775 50412980 ~ 50434788 (-) True LOC110530021
XM_021612797.2 mRNA upstream 679426 50665631 ~ 50674317 (-) False LOC110530027
TU816422 other downstream 94137 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 145693 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 1194427 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 1200874 48782121 ~ 48782515 (-) True G716480
TU814203 other downstream 1222226 48759912 ~ 48761163 (-) True G716463
TU817090 other upstream 950723 50936928 ~ 50939471 (-) True G719151
TU817704 other upstream 1266150 51252355 ~ 51259019 (-) True LOC110530043
TU819491 other upstream 2774834 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 3476977 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 3511943 53498148 ~ 53499730 (-) True G722459

Expression Profile


LOC118965625 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.5.
End of interactive chart.

LOC118965625 Expression in each Bioproject

Bar chart with 1 bar.
LOC118965625 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.