RNA id: XM_021612815.2



Basic Information


Item Value
RNA id XM_021612815.2
length 847
RNA type mRNA
GC content 0.44
exon number 3
gene id LOC110530043
representative False

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51252355 ~ 51259061 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GATACTGACTACGCTCAGGCGCTGCATGATTACATTGGCTTTCTTTCCTGCTCGAGCCAAGACGTGTGTTAACGTTGAAGTGGGGGTAGCTATAGTTGGAGACACTAAATTGACCCGTAAGCAGTGCAACATTGGCTGTGAAGGTCTTGTCCTAGAAACGACATATTTGAGTGAATAGGAAGCTGTATATTTTTAACAAATTCAAAAATGTCTTGGCAAAGCTACGTGGATAACCTGATGGCCGACGGCAGCTGTCAGGATTCCGCCATTGTTGGGTATACGGACGCCAAATACGTTTGGGCAGCACATGCCGGTGGTACTTTTAGCAACATAACGCCTCAAGAAATTGATGTCCTCATTGGAAAGGACAGGACTAGCTTCTTCACCAACGGCATGGCCTTGGGTTCAAAGAAGTGCTCGGTCATCAGAGACAGCCTCCATAGTGAAGGGGACTGGACAATGGACATCAGGACAAAGAGTCAAGGAGGAGAGCCAACGTACAACATTACTGTAGGCAAAGCTGGCAAAGTCTTGGTTCTTGTAATGGGCAAAGAAGGGGTCCATGGAGGCGGATTGAATAAGAAGGCATACTCAATGGCAAAATACTTGAGGGATTCGGGGTTCTAGTGTCACCAAGCTTGCTTAGTTAAAATTGAGGGACAAAAAGAAGAGAATAAATATTGCTTTTAAGATTTCTTCTGCAAACAGGCAAATGTCGTGGAAACTTTAATAGCAATGAAGAGTAATGGTCGTGGTGGGAACATCCTATGTCACTTTTATCCCCACTCTTAGTGGGGAAAAAGACTATTTTCAGTTTTGTTCATTTTTCTTTTTGTTTCCTTGTGTG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817686 lncRNA downstream 25494 51228401 ~ 51228671 (-) True G719702
TU817685 lncRNA downstream 25863 51228088 ~ 51228302 (-) True G719701
TU817681 lncRNA downstream 29400 51224529 ~ 51224765 (-) True G719697
TU817680 lncRNA downstream 29759 51223886 ~ 51224406 (-) True G719696
TU817608 lncRNA downstream 112962 51136329 ~ 51141203 (-) True LOC110530042
TU817748 lncRNA upstream 52828 51311889 ~ 51312674 (-) False G719761
TU817752 lncRNA upstream 52828 51311889 ~ 51312602 (-) True G719761
TU817756 lncRNA upstream 54247 51313308 ~ 51313537 (-) True G719762
TU817763 lncRNA upstream 69145 51328206 ~ 51328432 (-) True G719767
TU817790 lncRNA upstream 120158 51379219 ~ 51380062 (-) True LOC110530046
XM_021612813.2 mRNA downstream 64553 51127614 ~ 51189612 (-) False LOC110530042
XM_036985599.1 mRNA downstream 186364 51032565 ~ 51067801 (-) False LOC110530040
XR_005052895.1 mRNA downstream 186516 51066307 ~ 51067649 (-) False LOC110530040
XM_021612810.2 mRNA downstream 186545 51032565 ~ 51067620 (-) False LOC110530040
XM_021612808.2 mRNA downstream 186546 51032565 ~ 51067619 (-) False LOC110530040
XM_036985600.1 mRNA upstream 57233 51316294 ~ 51323226 (-) False LOC110530045
XM_021612821.2 mRNA upstream 57233 51316294 ~ 51323599 (-) False LOC110530045
XM_021612822.2 mRNA upstream 57233 51316294 ~ 51323600 (-) False LOC110530045
XM_021612823.2 mRNA upstream 58931 51317992 ~ 51323600 (-) False LOC110530045
XM_036985601.1 mRNA upstream 58931 51317992 ~ 51323600 (-) True LOC110530045
TU817090 other downstream 314694 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1364913 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1416469 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2465203 48788521 ~ 48788962 (-) True G716488
TU814220 other downstream 2471650 48782121 ~ 48782515 (-) True G716480
TU819491 other upstream 1501978 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2204121 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2239087 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2544382 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 2667167 53926228 ~ 53927959 (-) True G722670

Expression Profile


XM_021612815.2 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

XM_021612815.2 Expression in each Bioproject

Bar chart with 17 bars.
XM_021612815.2 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.