RNA id: TU817790



Basic Information


Item Value
RNA id TU817790
length 261
lncRNA type sense_over
GC content 0.57
exon number 2
gene id LOC110530046
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 51377904 ~ 51380863 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGGCCGAGTTTTGGTTCTGACAGACACTGGAGTGTCCACAGGCAGCAGCAGACGGCACGCCACCGACAGGTCACCAAAATGCTATGCGTACTGGTGATCGTCTTCGGCATCTGCTGGGCTCCCTTCCACATTGACCGCCTCATGTGGAGCTTCATAAACTCCTGGACTGGCCACCACCACCTGGTCTTTGAGTACGTCCACATAGTCTCCGGGGTCTTCTTCTACCTCAGCTCGGTGGTCAACCCCATCCTCTACAGCCTC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU817763 lncRNA downstream 50787 51328206 ~ 51328432 (-) True G719767
TU817756 lncRNA downstream 65682 51313308 ~ 51313537 (-) True G719762
TU817748 lncRNA downstream 66545 51311889 ~ 51312674 (-) False G719761
TU817752 lncRNA downstream 66617 51311889 ~ 51312602 (-) True G719761
TU817686 lncRNA downstream 150548 51228401 ~ 51228671 (-) True G719702
TU817833 lncRNA upstream 58892 51438954 ~ 51439395 (-) True G719835
TU817839 lncRNA upstream 65158 51445220 ~ 51445520 (-) True G719841
TU817840 lncRNA upstream 66677 51446739 ~ 51446984 (-) True G719842
TU817852 lncRNA upstream 85914 51465976 ~ 51466228 (-) True G719854
TU817888 lncRNA upstream 131225 51511287 ~ 51575248 (-) True G719886
XM_021612822.2 mRNA downstream 55619 51316294 ~ 51323600 (-) False LOC110530045
XM_021612823.2 mRNA downstream 55619 51317992 ~ 51323600 (-) False LOC110530045
XM_036985601.1 mRNA downstream 55619 51317992 ~ 51323600 (-) True LOC110530045
XM_021612821.2 mRNA downstream 55620 51316294 ~ 51323599 (-) False LOC110530045
XM_036985600.1 mRNA downstream 55993 51316294 ~ 51323226 (-) False LOC110530045
XM_021612828.2 mRNA upstream 116018 51496080 ~ 51516909 (-) True mfsd8l2
XM_021612831.2 mRNA upstream 145205 51525267 ~ 51546934 (-) True LOC110530051
XM_021612832.2 mRNA upstream 180738 51560800 ~ 51582355 (-) True LOC110530052
XM_021612833.2 mRNA upstream 203463 51583525 ~ 51591883 (-) False LOC110530053
XM_021612841.2 mRNA upstream 268476 51648538 ~ 51689345 (-) True si:dkey-18p12.4
TU817704 other downstream 120200 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 439748 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 1489967 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 1541523 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 2590257 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 1380977 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 2083120 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 2118086 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 2423381 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 2546166 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU817790 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

TU817790 Expression in each Bioproject

Bar chart with 5 bars.
TU817790 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7.
End of interactive chart.