RNA id: TU820028



Basic Information


Item Value
RNA id TU820028
length 430
lncRNA type sense_over
GC content 0.41
exon number 1
gene id LOC110529122
representative False

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 53462034 ~ 53478913 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGGCTGGTCCCCAGTACAAAGCAGGATGGAGATTCTGTAGAGTGTCTATGATCATGGAGTGAGGCCACGCGTCTTCCTGTTGTACATTTTCTGTTGAGGATAAAGTGGATTCGGTTGTAATGAGAGACTGTCATGACCGAATGGCAAGACAGTCTCTGGGAACAGTTTTTAACAAGATGGTGACCAGACAATGGTAGGATCTTAATATTCACAGCAGTTGGGATATGTATAAGACTGACCTGGAGTACTGATTAAAATATTGACTCAAAGGTCAAAAAGAGGACCATATCTCATTGCATTTGACCACAAGTAGACAGGCTCAAAACAGGGATTTTCCGTAACTTCATTTTTTCAATGTTCTCTTGAATTGTACGAAACGGATGCCATGCATCTCTTTGCATTACTGCATTATAGTCAACATATTTATTAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU820019 lncRNA downstream 4397 53457822 ~ 53458026 (-) True G721782
TU820002 lncRNA downstream 18338 53443792 ~ 53444085 (-) True G721766
TU819983 lncRNA downstream 31471 53430703 ~ 53430952 (-) True G721747
TU819940 lncRNA downstream 74743 53387475 ~ 53387680 (-) True G721704
TU819918 lncRNA downstream 86176 53376030 ~ 53376247 (-) True G721685
TU820041 lncRNA upstream 948 53463800 ~ 53477483 (-) True LOC110529122
TU820062 lncRNA upstream 18041 53480893 ~ 53481125 (-) True G721825
TU820770 lncRNA upstream 32952 53495804 ~ 53497427 (-) False G722459
TU820773 lncRNA upstream 64744 53527596 ~ 53533919 (-) True LOC118965526
TU820801 lncRNA upstream 132704 53595556 ~ 53595773 (-) True G722488
XM_036985657.1 mRNA downstream 102178 53342603 ~ 53360245 (-) True nsun4
XM_036985654.1 mRNA downstream 203908 53255197 ~ 53258515 (-) True LOC110530106
XM_021612923.2 mRNA downstream 204593 53255197 ~ 53257830 (-) False LOC110530106
XM_036985655.1 mRNA downstream 204834 53255197 ~ 53257589 (-) False LOC110530106
XM_021612915.2 mRNA downstream 394637 53059646 ~ 53067786 (-) True dipk1aa
XM_021612937.2 mRNA upstream 37604 53500456 ~ 53569137 (-) False LOC110530111
XM_021612934.2 mRNA upstream 37604 53500456 ~ 53569139 (-) False LOC110530111
XM_021612935.2 mRNA upstream 37604 53500456 ~ 53585618 (-) False LOC110530111
XM_021612938.2 mRNA upstream 37604 53500456 ~ 53585618 (-) False LOC110530111
XM_021612931.2 mRNA upstream 37604 53500456 ~ 53585620 (-) False LOC110530111
TU819491 other downstream 700972 52761039 ~ 52761451 (-) True G721275
TU817704 other downstream 2203404 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 2522952 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 3573171 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 3624727 49785674 ~ 49837696 (-) True G718489
TU820029 other upstream 330 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 35296 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 340591 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 463376 53926228 ~ 53927959 (-) True G722670
TU821119 other upstream 661527 54124379 ~ 54139341 (-) True G722761

Expression Profile


TU820028 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU820028 Expression in each Bioproject

Bar chart with 11 bars.
TU820028 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.