RNA id: XR_005053060.1



Basic Information


Item Value
RNA id XR_005053060.1
length 134
RNA type mRNA
GC content 0.45
exon number 1
gene id LOC118965682
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54002434 ~ 54002567 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TTGCATTGTGGTATGTCGGTGAAAGCTCAGCTTTTACCGTGAGTGTATCCAACATACCAATGCTAAATGAACCCCATCTTGCAGAAGGGTGAAAGTCTGTGGCAGTGGCACTCTTTCGAAAGTTGGGTACATTT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU821055 lncRNA downstream 37027 53965176 ~ 53965407 (-) True G722699
TU821045 lncRNA downstream 48005 53954197 ~ 53954429 (-) True G722696
TU821043 lncRNA downstream 50034 53952195 ~ 53952400 (-) True G722694
TU821035 lncRNA downstream 57488 53944594 ~ 53944946 (-) True G722686
TU821007 lncRNA downstream 96972 53905148 ~ 53905462 (-) True G722659
TU821086 lncRNA upstream 30724 54033291 ~ 54034722 (-) True G722728
TU821166 lncRNA upstream 177875 54180442 ~ 54185532 (-) True G722805
TU821173 lncRNA upstream 185502 54188069 ~ 54189214 (-) True G722812
TU821176 lncRNA upstream 186825 54189392 ~ 54243058 (-) True G722814
TU821132 lncRNA upstream 202121 54204688 ~ 54207815 (-) True G722773
XM_036985678.1 mRNA downstream 7130 53965997 ~ 53995304 (-) False LOC110530121
XM_036985679.1 mRNA downstream 7130 53965997 ~ 53995304 (-) False LOC110530121
XM_036985680.1 mRNA downstream 7130 53981409 ~ 53995304 (-) True LOC110530121
XM_021614230.2 mRNA downstream 84817 53914820 ~ 53917617 (-) True insl3
XM_036985677.1 mRNA downstream 121649 53825024 ~ 53880785 (-) False LOC110530934
XM_036985681.1 mRNA upstream 5867 54008434 ~ 54014434 (-) True cnn2
XM_021612954.2 mRNA upstream 22169 54024736 ~ 54039571 (-) False crsp7
XM_021612953.2 mRNA upstream 22169 54024736 ~ 54039572 (-) True crsp7
XM_021612959.2 mRNA upstream 55555 54058122 ~ 54105410 (-) True LOC110530125
XM_021612960.2 mRNA upstream 124501 54127068 ~ 54131739 (-) True LOC110530126
TU821019 other downstream 74475 53926228 ~ 53927959 (-) True G722670
TU820950 other downstream 146369 53803443 ~ 53856065 (-) True G722602
TU820769 other downstream 502704 53498148 ~ 53499730 (-) True G722459
TU820029 other downstream 538670 53463182 ~ 53463764 (-) False LOC110529122
TU819491 other downstream 1240983 52761039 ~ 52761451 (-) True G721275
TU821119 other upstream 121812 54124379 ~ 54139341 (-) True G722761
TU821220 other upstream 248547 54251114 ~ 54251546 (-) True G722854
TU821231 other upstream 279118 54281685 ~ 54281978 (-) True G722864
TU822417 other upstream 1374714 55377281 ~ 55377776 (-) True G723955
TU822429 other upstream 1394057 55396624 ~ 55396885 (-) True G723966

Expression Profile


XR_005053060.1 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

XR_005053060.1 Expression in each Bioproject

Bar chart with 12 bars.
XR_005053060.1 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.