RNA id: TU779680



Basic Information


Item Value
RNA id TU779680
length 382
lncRNA type intronic
GC content 0.60
exon number 2
gene id G684690
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 21287752 ~ 21291905 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


caggctctgtcgtaacccggccgcgaccgggaggtccgtggggcgacgcacaattggcctagcgtcgcccgggttagggagggcttggtcggtaggggtgtccttgtctcatcgcgcaccagcgactcctgtggcgggctgggcgcagtgtgcgctaaccaaggtggccaggtgcacagtgtttcctccggcgcattggtgcggctggcttccgggttggatgtgcgctgtgttgaagaagcagcggcttggttggttgtgtatcggaggacgcatgactttcaaccttcatctctcccgagcccgtacgggagttgtagcgatgagacaagatagtagctactacacaattggatactacgaaattggggagaaaaagggg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU779705 lncRNA downstream 11051 21276176 ~ 21276701 (-) True G684714
TU779641 lncRNA downstream 90655 21187535 ~ 21197097 (-) False LOC110529586
TU779642 lncRNA downstream 90655 21187535 ~ 21197097 (-) True LOC110529586
TU779162 lncRNA downstream 279127 21008334 ~ 21008625 (-) True G684268
TU779152 lncRNA downstream 288955 20998486 ~ 20998797 (-) True G684258
TU779803 lncRNA upstream 92013 21383918 ~ 21384286 (-) True G684789
TU779805 lncRNA upstream 95225 21387130 ~ 21387516 (-) True G684791
TU779806 lncRNA upstream 95911 21387816 ~ 21388049 (-) True G684792
TU779810 lncRNA upstream 111135 21403040 ~ 21403274 (-) True LOC110529589
TU779778 lncRNA upstream 129889 21421794 ~ 21424438 (-) False G684767
NM_001197208.2 mRNA downstream 46602 21231292 ~ 21241150 (-) True si:dkeyp-114g9.1
XM_021611928.2 mRNA downstream 90554 21189811 ~ 21197198 (-) False LOC110529586
XM_021611927.2 mRNA downstream 90560 21187530 ~ 21197192 (-) False LOC110529586
XR_005052832.1 mRNA downstream 90581 21187530 ~ 21197171 (-) False LOC110529586
LOC118965500 mRNA downstream 635208 20650227 ~ 20652544 (-) True LOC118965500
XM_021611931.2 mRNA upstream 100433 21392338 ~ 21401110 (-) True LOC110529588
XM_021611932.2 mRNA upstream 110038 21401943 ~ 21406071 (-) False LOC110529589
XM_021611935.2 mRNA upstream 133714 21425619 ~ 21469294 (-) True LOC110529592
XM_021611936.2 mRNA upstream 207560 21499465 ~ 21504645 (-) False LOC110529593
XM_021611937.2 mRNA upstream 207560 21499465 ~ 21504647 (-) True LOC110529593
TU776244 other downstream 2495615 18791230 ~ 18792137 (-) True G681659
TU773944 other downstream 4173224 17113543 ~ 17114528 (-) True G679471
TU773640 other downstream 4657493 16625090 ~ 16630259 (-) False G679210
TU773642 other downstream 4657493 16625090 ~ 16630259 (-) True G679210
TU773511 other downstream 4854738 16432621 ~ 16433014 (-) True G679087
TU779858 other upstream 186861 21478766 ~ 21479203 (-) True G684844
TU780899 other upstream 628522 21920427 ~ 21924908 (-) False LOC110529207
TU780900 other upstream 628522 21920427 ~ 21924908 (-) True LOC110529207
TU781111 other upstream 867125 22159030 ~ 22161042 (-) False G685953
TU783285 other upstream 2325002 23616907 ~ 23621246 (-) True LOC110529643

Expression Profile


TU779680 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU779680 Expression in each Bioproject

Bar chart with 19 bars.
TU779680 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.