RNA id: TCONS_00035597


Basic Information

Item Value
RNA id TCONS_00035597
length 611
RNA type mRNA
GC content 0.55
exon number 3
gene id XLOC_018064
representative True

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 23431485 ~ 23440955 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AATTTCAACAAATGGTTAGGCCTATTACCATAAAGAAAACCATCATCATGACCATCTCCTCCACTCTCCTGGCCCTTGTGCTCATGCCGCTGTGTCTGTGGATGTATAGTCGCGCATGGATCAACACACCAGTGGTGGACCTTCTGCCCTTCGGCCCCATCATTCTGACCCTGTGCAGCACCCTCATCCCCATCGGCCTTGGCGTCTGGCTGAGACAGCGCTACATTCACGTGGCAGAAGTCATCATCAAGGTGTCTCTGTGGTCTCTCCTGGTGACTCTGCTGATGCTCTTCATCATGACTGGCACTATGCTGGGCCCGGAGCTGCTGGCCACCATCCCTGCCTCTGTGTACCTGGTGGCTGTGCTCATGCCAATGGCTGGCTACACTGCAGGATACGGCCTTGCCACGCTCTTCGACCTCCCCCCTAACAGCCGCAGGACTGTCTCTTTAGAGACCGGATGCCAGAACATTCAGCTCTGCACTGCTATCCTGAAATTGGCGTTCCCCCCGCAGTTGATGGGTGGCATGTACATGTTTCCTTTGCTGTACGCTCTCTTCCAGGCCGCAGAGGCTGGCATCTTCATCCTGGTTTACCGCATGTACAGGAAA

Function

GO:

id name namespace
GO:0015721 bile acid and bile salt transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008508 bile acid molecular_function

KEGG:

id description
ko02000 Transporters

ZFIN:

id description
ZDB-GENE-041014-249 Predicted to enable bile acid:sodium symporter activity. Predicted to be involved in bile acid and bile salt transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in blood; nervous system; and ventral mesoderm. Orthologous to human SLC10A4 (solute carrier family 10 member 4).

Ensembl:

ensembl_id ENSDART00000153386

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036473 lncRNA downstream 235235 23194788 ~ 23196658 (-) True XLOC_018060
TCONS_00036472 lncRNA downstream 260534 23169183 ~ 23171359 (-) True XLOC_018059
TCONS_00036835 lncRNA downstream 262925 23160676 ~ 23168968 (-) False XLOC_018059
TCONS_00035585 lncRNA downstream 268315 23160676 ~ 23163578 (-) False XLOC_018059
TCONS_00035600 lncRNA upstream 39498 23480453 ~ 23488144 (-) False XLOC_018066
TCONS_00036836 lncRNA upstream 467639 23908594 ~ 23946098 (-) True XLOC_018071
TCONS_00035610 lncRNA upstream 623734 24064689 ~ 24122757 (-) False XLOC_018072
TCONS_00035615 lncRNA upstream 711723 24152678 ~ 24159764 (-) False XLOC_018073
TCONS_00035617 lncRNA upstream 730713 24171668 ~ 24181988 (-) False XLOC_018073
TCONS_00035594 mRNA downstream 5554 23423814 ~ 23426339 (-) False XLOC_018063
TCONS_00035592 mRNA downstream 177017 23245620 ~ 23254876 (-) False XLOC_018062
TCONS_00035591 mRNA downstream 178263 23245620 ~ 23253630 (-) False XLOC_018062
TCONS_00035588 mRNA downstream 205440 23203946 ~ 23226453 (-) False XLOC_018061
TCONS_00035598 mRNA upstream 5288 23446243 ~ 23472319 (-) True XLOC_018065
TCONS_00035599 mRNA upstream 34426 23475381 ~ 23494695 (-) False XLOC_018066
TCONS_00035601 mRNA upstream 47562 23488517 ~ 23494712 (-) True XLOC_018066
TCONS_00035602 mRNA upstream 209877 23650832 ~ 23657304 (-) False XLOC_018067
TCONS_00035603 mRNA upstream 210246 23651201 ~ 23656516 (-) True XLOC_018067
TCONS_00035595 other downstream 6239 23423846 ~ 23425654 (-) True XLOC_018063
TCONS_00035593 other downstream 183254 23245639 ~ 23248639 (-) True XLOC_018062
TCONS_00035590 other downstream 205517 23223900 ~ 23226376 (-) True XLOC_018061
TCONS_00035586 other downstream 268636 23161279 ~ 23163257 (-) False XLOC_018059
TCONS_00035582 other downstream 349703 23082069 ~ 23082190 (-) False XLOC_018056
TCONS_00035611 other upstream 642184 24083139 ~ 24122757 (-) True XLOC_018072
TCONS_00035616 other upstream 711844 24152799 ~ 24172140 (-) False XLOC_018073
TCONS_00035626 other upstream 1927555 25368510 ~ 25369880 (-) False XLOC_018081
TCONS_00035635 other upstream 2096625 25537580 ~ 25538417 (-) False XLOC_018086
TCONS_00035636 other upstream 2097400 25538355 ~ 25540754 (-) True XLOC_018086

Expression Profile

//