RNA id: TU794124



Basic Information


Item Value
RNA id TU794124
length 216
lncRNA type intronic
GC content 0.44
exon number 1
gene id G697780
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 32509091 ~ 32509306 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGCAGGGAAAGGGGGTGACCGGAAAAGTGAAAGGTGGGGGAGGGAGAACATTTTATATAGTTATCAACACCTCAGTGACCATGAGAACGTATAGTCATAACTGTTATAGACTATAATTGGGATTTTTAAGTGCTTGTGTTACATCACCAGCTATTGCATCTTCCAACACCTGCTTCCAAACCCCCTCCTGTAAACTGTCCAACCACTAGATGTCCT

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU794117 lncRNA downstream 11121 32497732 ~ 32497970 (-) True G697773
TU794108 lncRNA downstream 23736 32483825 ~ 32485355 (-) True G697764
TU794106 lncRNA downstream 27836 32480686 ~ 32481255 (-) True G697762
TU794104 lncRNA downstream 29784 32479001 ~ 32479307 (-) True G697760
TU794102 lncRNA downstream 31339 32477480 ~ 32477752 (-) True G697758
TU794125 lncRNA upstream 2299 32511605 ~ 32518649 (-) False G697781
TU794126 lncRNA upstream 4827 32514133 ~ 32518649 (-) False G697781
TU794127 lncRNA upstream 4827 32514133 ~ 32518728 (-) False G697781
TU794129 lncRNA upstream 4827 32514133 ~ 32518774 (-) True G697781
TU794152 lncRNA upstream 20326 32529632 ~ 32529990 (-) True G697803
XR_005053020.1 mRNA downstream 88006 32417472 ~ 32421085 (-) True LOC118965610
XR_005052856.1 mRNA downstream 186951 32306142 ~ 32322140 (-) False LOC110529812
XR_005052857.1 mRNA downstream 186951 32306142 ~ 32322140 (-) False LOC110529812
XM_036985297.1 mRNA downstream 186951 32318440 ~ 32322140 (-) True LOC110529812
XM_036985293.1 mRNA downstream 207798 32289064 ~ 32301293 (-) True LOC110529806
XM_021614360.2 mRNA upstream 53825 32563131 ~ 32569877 (-) True LOC110531086
XM_036985337.1 mRNA upstream 60710 32570016 ~ 32589797 (-) False cep43
XM_036985335.1 mRNA upstream 60710 32570016 ~ 32589808 (-) False cep43
XM_036985336.1 mRNA upstream 60710 32570016 ~ 32589809 (-) False cep43
XM_036985332.1 mRNA upstream 60710 32570016 ~ 32589810 (-) False cep43
TU794118 other downstream 9681 32498799 ~ 32499410 (-) True G697774
TU793919 other downstream 291542 32214486 ~ 32217549 (-) False LOC110529804
TU793920 other downstream 291542 32214486 ~ 32217549 (-) True LOC110529804
TU792983 other downstream 829356 31657726 ~ 31679735 (-) True LOC110529793
TU792778 other downstream 1031064 31477354 ~ 31478027 (-) True G696499
TU794745 other upstream 479939 32989245 ~ 32990061 (-) True G698356
TU795919 other upstream 1433716 33943022 ~ 33952356 (-) True G699468
TU795985 other upstream 1513985 34023291 ~ 34023885 (-) True ankef1a
TU798118 other upstream 3073692 35582998 ~ 35589877 (-) True G701454
TU798044 other upstream 3132049 35641355 ~ 35687636 (-) False LOC110529865

Expression Profile


TU794124 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

TU794124 Expression in each Bioproject

Bar chart with 5 bars.
TU794124 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 16.
End of interactive chart.