RNA id: TCONS_00035635


Basic Information

Item Value
RNA id TCONS_00035635
length 500
RNA type processed_transcript
GC content 0.43
exon number 4
gene id XLOC_018086
representative False

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 25534669 ~ 25542183 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAGGACTGGGACCCTGCAAACCCACGTGACTTTATCGACAACTACCTGACTGAGATGGAAAAGAAAAAGAGTGACCCTCAAGCTGGCTTTAACATAGAAAGTTTAATCATTTCTTGCCTAGACATAGTTGAGGCTGGGACAGAGACGGGTGCGACTACATTACGCTGGGGTCTGCTTTTTATGATCAAGTTCCCAGAAATACAGAAAAAAGTCCAGGCAGAGATAGACAGAGTGATTGGACAGTCACGTCAACCCTGCTTGGATGACAGAGTTAATATGCCCTATACTGAAGCTGTTTTACATGAGATTCAAAGATTTGGGGATGTTGTTCCACTTGGATTCCCCAAACAAGCAGCTGTAGACACAAAAATTGGGAACTACTTCATTCCAAAGTCTGAACAAATCCAGTAGATTTCATTCTCTCTTTATTAGGGGACTTCTATTACAACAAACCTGTCTTCGGTCCTGCATGATCCAAACGAATGGGAAACCCCAGACAC

Function

GO:

id name namespace
GO:0042738 exogenous drug catabolic process biological_process
GO:0006082 organic acid metabolic process biological_process
GO:0055114 oxidation-reduction process biological_process
GO:0006805 xenobiotic metabolic process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008395 steroid hydroxylase activity molecular_function
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular_function
GO:0016712 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen molecular_function
GO:0004497 monooxygenase activity molecular_function
GO:0005506 iron ion binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-020812-2 Predicted to enable heme binding activity; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen; and steroid hydroxylase activity. Predicted to be involved in exogenous drug catabolic process; organic acid metabolic process; and xenobiotic metabolic process. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in cytoplasm and intracellular membrane-bounded organelle. Is expressed in intestine; kidney; liver; and spleen. Human ortholog(s) of this gene implicated in hypertension; myocardial infarction; pulmonary hypertension; renal fibrosis; and renal hypertension. Orthologous to human CYP2J2 (cytochrome P450 family 2 subfamily J member 2).

Ensembl:

ensembl_id ENSDART00000130500

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036840 lncRNA downstream 125399 25401086 ~ 25412181 (-) True XLOC_018081
TCONS_00036839 lncRNA downstream 226126 25307795 ~ 25311454 (-) True XLOC_018080
TCONS_00036476 lncRNA downstream 805271 24729131 ~ 24732309 (-) True XLOC_018078
TCONS_00036838 lncRNA downstream 1082651 24448007 ~ 24454929 (-) False XLOC_018077
TCONS_00035620 lncRNA downstream 1082651 24449637 ~ 24454929 (-) True XLOC_018077
TCONS_00035638 lncRNA upstream 10008 25548425 ~ 25551676 (-) False XLOC_018087
TCONS_00035640 lncRNA upstream 61688 25600105 ~ 25605285 (-) True XLOC_018088
TCONS_00036841 lncRNA upstream 127632 25666049 ~ 25669922 (-) False XLOC_018091
TCONS_00035653 lncRNA upstream 172374 25710791 ~ 25712415 (-) True XLOC_018092
TCONS_00036842 lncRNA upstream 524128 26062545 ~ 26070949 (-) True XLOC_018101
TCONS_00035633 mRNA downstream 3841 25525802 ~ 25533739 (-) True XLOC_018085
TCONS_00035631 mRNA downstream 14669 25515259 ~ 25522911 (-) False XLOC_018084
TCONS_00035632 mRNA downstream 19092 25515260 ~ 25518488 (-) True XLOC_018084
TCONS_00035630 mRNA downstream 51196 25473056 ~ 25486384 (-) True XLOC_018083
TCONS_00035629 mRNA downstream 56274 25473056 ~ 25481306 (-) False XLOC_018083
TCONS_00035637 mRNA upstream 10008 25548425 ~ 25551676 (-) False XLOC_018087
TCONS_00035641 mRNA upstream 79697 25618114 ~ 25626198 (-) False XLOC_018089
TCONS_00035642 mRNA upstream 79697 25618114 ~ 25626428 (-) False XLOC_018089
TCONS_00035643 mRNA upstream 79697 25618114 ~ 25626693 (-) False XLOC_018089
TCONS_00035644 mRNA upstream 79697 25618114 ~ 25631256 (-) True XLOC_018089
TCONS_00035626 other downstream 167700 25368510 ~ 25369880 (-) False XLOC_018081
TCONS_00035616 other downstream 1365440 24152799 ~ 24172140 (-) False XLOC_018073
TCONS_00035611 other downstream 1414823 24083139 ~ 24122757 (-) True XLOC_018072
TCONS_00035595 other downstream 2111926 23423846 ~ 23425654 (-) True XLOC_018063
TCONS_00035593 other downstream 2288941 23245639 ~ 23248639 (-) True XLOC_018062
TCONS_00035639 other upstream 11008 25549425 ~ 25550816 (-) True XLOC_018087
TCONS_00035648 other upstream 104263 25642680 ~ 25644837 (-) True XLOC_018090
TCONS_00035651 other upstream 127632 25666049 ~ 25709349 (-) False XLOC_018091
TCONS_00035674 other upstream 580922 26119339 ~ 26119459 (-) True XLOC_018102
TCONS_00035675 other upstream 656309 26194726 ~ 26194841 (-) True XLOC_018103

Expression Profile

//