RNA id: TU806496



Basic Information


Item Value
RNA id TU806496
length 401
lncRNA type antisense_over
GC content 0.54
exon number 2
gene id G709197
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 42580275 ~ 42627363 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aaacagcaggtctgggacaggtagcacgtccggtgaacaggtcagggttccatagccgcaggcagaacagttgaaactggagcagcagcacggccaagtggactggtagtcctgaggcatggtcctagggctcaggtcctccgagagagagaaagaaagagagaattagagagagcatacttaaattcacacaggacactggataagacaggagaaatataacagactgaccctagccccccgacacataaactactgcagcataaatactggaggctgagacaggaggggtcaggagacactgtggccccatccgatgatacccccggacagggccaaacaggcaggatataaccccacccactttgccaaagcacagcccccacaccactagagggata

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU806377 lncRNA downstream 150099 42429418 ~ 42430176 (-) True G709096
TU806114 lncRNA downstream 253645 42326342 ~ 42326630 (-) True G708852
TU806087 lncRNA downstream 269630 42253104 ~ 42310645 (-) False G708827
TU806565 lncRNA upstream 84180 42711543 ~ 42711868 (-) True G709263
TU806593 lncRNA upstream 103535 42730898 ~ 42741496 (-) True G709282
TU806644 lncRNA upstream 428255 43055618 ~ 43060881 (-) True G709322
TU806653 lncRNA upstream 443072 43070435 ~ 43070702 (-) True G709329
TU806654 lncRNA upstream 443363 43070726 ~ 43070940 (-) True G709330
XM_021612583.2 mRNA downstream 53689 42431791 ~ 42526586 (-) True puf60a
XM_021612585.2 mRNA downstream 53748 42431791 ~ 42526527 (-) False puf60a
XM_021612584.2 mRNA downstream 54606 42431791 ~ 42525669 (-) False puf60a
XM_036985478.1 mRNA downstream 160188 42340682 ~ 42420087 (-) False klhl18
XM_036985479.1 mRNA downstream 160188 42340682 ~ 42420087 (-) True klhl18
XM_021612591.2 mRNA upstream 972391 43599754 ~ 43602305 (-) False mycb
XM_021612593.2 mRNA upstream 972391 43599754 ~ 43602305 (-) True mycb
XR_005053023.1 mRNA upstream 1131966 43759329 ~ 43763318 (-) True LOC118965613
XM_021612600.2 mRNA upstream 1557630 44184993 ~ 44436559 (-) False efr3a
XM_021612601.2 mRNA upstream 1557630 44184993 ~ 44436559 (-) False efr3a
TU804129 other downstream 2620662 39956961 ~ 39959613 (-) True slc22a16
TU803684 other downstream 3353962 39219644 ~ 39226313 (-) True G706683
TU801790 other downstream 4266472 38313489 ~ 38313803 (-) True G704874
TU801610 other downstream 4541929 38037725 ~ 38038346 (-) True G704702
TU800488 other downstream 5088118 37489227 ~ 37492157 (-) True LOC110530908
TU806574 other upstream 92408 42719771 ~ 42720699 (-) True G709272
TU806781 other upstream 543397 43170760 ~ 43171082 (-) True G709454
TU808567 other upstream 1911430 44538793 ~ 44539504 (-) True G711133
TU810338 other upstream 2830414 45457777 ~ 45458248 (-) True G712814
TU811283 other upstream 3683767 46311130 ~ 46325681 (-) True crfb16

Expression Profile


TU806496 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU806496 Expression in each Bioproject

Bar chart with 20 bars.
TU806496 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.